Incidental Mutation 'R6937:Mak'
ID540356
Institutional Source Beutler Lab
Gene Symbol Mak
Ensembl Gene ENSMUSG00000021363
Gene Namemale germ cell-associated kinase
SynonymsA930010O05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location41025008-41079706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41048102 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 261 (M261K)
Ref Sequence ENSEMBL: ENSMUSP00000152946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021792] [ENSMUST00000070193] [ENSMUST00000165087] [ENSMUST00000224423] [ENSMUST00000224740] [ENSMUST00000225084]
Predicted Effect probably damaging
Transcript: ENSMUST00000021792
AA Change: M261K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021792
Gene: ENSMUSG00000021363
AA Change: M261K

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070193
AA Change: M230K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064750
Gene: ENSMUSG00000021363
AA Change: M230K

DomainStartEndE-ValueType
S_TKc 4 253 3.81e-70 SMART
low complexity region 325 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165087
AA Change: M261K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129615
Gene: ENSMUSG00000021363
AA Change: M261K

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224423
Predicted Effect probably damaging
Transcript: ENSMUST00000224740
AA Change: M261K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225084
AA Change: M261K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit slight reductions in litter size and sperm motility in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Mak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Mak APN 13 41055689 splice site probably benign
IGL00543:Mak APN 13 41055713 missense probably damaging 1.00
IGL00772:Mak APN 13 41055820 splice site probably benign
IGL01113:Mak APN 13 41042143 missense probably damaging 1.00
IGL01363:Mak APN 13 41053377 splice site probably benign
IGL01673:Mak APN 13 41048223 splice site probably null
IGL01872:Mak APN 13 41056655 missense probably damaging 1.00
IGL02051:Mak APN 13 41042082 missense probably benign 0.00
R0126:Mak UTSW 13 41032596 missense probably damaging 1.00
R0377:Mak UTSW 13 41049348 missense probably damaging 1.00
R0511:Mak UTSW 13 41046267 missense probably benign
R0557:Mak UTSW 13 41039659 missense probably benign 0.11
R0616:Mak UTSW 13 41042185 missense probably benign 0.05
R0786:Mak UTSW 13 41046069 missense probably benign 0.00
R0855:Mak UTSW 13 41070164 missense probably damaging 1.00
R1430:Mak UTSW 13 41070284 start gained probably benign
R1603:Mak UTSW 13 41042106 missense possibly damaging 0.69
R1759:Mak UTSW 13 41056634 missense probably damaging 0.98
R2042:Mak UTSW 13 41049436 missense possibly damaging 0.60
R2148:Mak UTSW 13 41042037 missense probably benign 0.01
R2155:Mak UTSW 13 41032544 missense probably benign 0.00
R4124:Mak UTSW 13 41056630 missense probably benign 0.00
R5040:Mak UTSW 13 41030098 missense possibly damaging 0.61
R5141:Mak UTSW 13 41032563 missense possibly damaging 0.94
R6167:Mak UTSW 13 41053352 missense probably benign 0.07
R6964:Mak UTSW 13 41032591 missense probably benign 0.00
R7201:Mak UTSW 13 41051440 missense possibly damaging 0.94
R7474:Mak UTSW 13 41051480 missense probably damaging 1.00
R7644:Mak UTSW 13 41030110 missense probably benign 0.01
X0024:Mak UTSW 13 41051369 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTTAGCACTTACTGATCTTGG -3'
(R):5'- CCACATGAATCTGTGTCATTCC -3'

Sequencing Primer
(F):5'- GGGATCTGATGCCATCTACTAGC -3'
(R):5'- CTGTGTCATTCCTGAGTTATTACATC -3'
Posted On2018-11-06