Incidental Mutation 'R6937:Wapl'
ID 540358
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 045051-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6937 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34722354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 588 (V588I)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: V588I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: V588I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: V582I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: V582I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151285
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: V588I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: V588I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGGCATGGTAATAGCACTCAC -3'
(R):5'- GTCATGATTAAAAGCTCTGGTTTGG -3'

Sequencing Primer
(F):5'- AGCACTCACTGTTTTTGGTCTAAG -3'
(R):5'- TGTTGTTTAGTTTCTGAGATTGGGTC -3'
Posted On 2018-11-06