Mutagenetix > Incidental Mutation

Incidental Mutation 'R6937:Wapl'

540358

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

045051-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6937 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34722354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 588 (V588I)

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

AlphaFold

Q65Z40

Predicted Effect

probably benign
Transcript: ENSMUST00000048263
AA Change: V588I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: V588I

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090027
AA Change: V582I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: V582I

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151285

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169910
AA Change: V588I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: V588I

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd52	T	C	10: 128,387,020	V613A	probably benign	Het
Cdh23	A	T	10: 60,487,114	L337Q	probably damaging	Het
Chrna6	A	G	8: 27,407,027	L274P	probably damaging	Het
Ciita	G	A	16: 10,512,491		probably null	Het
Csnka2ip	A	T	16: 64,478,695		probably benign	Het
Ddx60	G	A	8: 62,037,069	D1691N	probably damaging	Het
Dnah7b	T	C	1: 46,195,120	I1441T	probably damaging	Het
Dock4	T	C	12: 40,834,635	S1713P	probably benign	Het
Ep400	T	C	5: 110,711,152		probably benign	Het
Epn1	T	C	7: 5,089,944	I85T	probably damaging	Het
Eri2	T	C	7: 119,786,789	K228E	probably damaging	Het
Garem1	C	T	18: 21,147,770	A510T	probably benign	Het
Gfm2	T	A	13: 97,163,064		probably null	Het
Gm37596	T	C	3: 93,692,216	N282S	probably benign	Het
Gm4858	A	G	3: 93,074,110	H145R	probably benign	Het
Hnrnpd	T	C	5: 99,963,770	T321A	probably benign	Het
Htr2a	A	T	14: 74,645,164	I197F	probably damaging	Het
Krtap2-4	T	A	11: 99,614,473		probably benign	Het
Lcn3	C	A	2: 25,767,811	Y179*	probably null	Het
Mak	A	T	13: 41,048,102	M261K	probably damaging	Het
March7	A	G	2: 60,240,966	T605A	probably damaging	Het
Mcm4	A	C	16: 15,636,335	F83V	probably benign	Het
Myo18b	T	C	5: 112,802,392	N1546S	probably benign	Het
Nckap1	T	A	2: 80,508,716	K989N	probably damaging	Het
Ndufaf5	A	G	2: 140,181,602	D119G	probably damaging	Het
Olfr846	A	T	9: 19,360,689	V222D	probably damaging	Het
Pcdh1	T	C	18: 38,203,475	T36A	possibly damaging	Het
Pitpna	C	T	11: 75,603,731	T100I	possibly damaging	Het
Pmf1	A	T	3: 88,399,189	L102Q	probably damaging	Het
Rftn2	T	C	1: 55,194,349		probably null	Het
Robo3	A	G	9: 37,429,880	L10P	probably benign	Het
Serpinb6a	T	C	13: 33,918,818	I241V	possibly damaging	Het
St14	A	T	9: 31,129,660		probably null	Het
Stat6	T	C	10: 127,658,702		probably null	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tgfbrap1	A	T	1: 43,051,904	V687E	probably damaging	Het
Trim30d	A	T	7: 104,483,427	S68T	probably damaging	Het
Ttn	A	G	2: 76,832,909		probably benign	Het
Ugt3a1	A	T	15: 9,292,072	D97V	probably benign	Het
Ugt8a	G	A	3: 125,915,601		probably benign	Het
Vmn1r184	A	T	7: 26,267,325	K165N	probably benign	Het
Vmn2r86	T	A	10: 130,448,654	I523F	probably damaging	Het
Wdr7	C	T	18: 63,791,867	P974S	probably benign	Het
Zfp975	T	C	7: 42,665,056	D31G	possibly damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
Tatum	UTSW	14	34729195	missense	probably damaging	1.00
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
R8688:Wapl	UTSW	14	34692592	missense	possibly damaging	0.94
R8864:Wapl	UTSW	14	34692202	missense	probably benign	0.03
R8988:Wapl	UTSW	14	34729182	missense	probably damaging	1.00
R9072:Wapl	UTSW	14	34677460	missense	possibly damaging	0.81
R9197:Wapl	UTSW	14	34722287	missense	probably damaging	1.00
R9259:Wapl	UTSW	14	34741095	missense	probably benign	0.00
R9545:Wapl	UTSW	14	34677093	missense	probably damaging	1.00
R9613:Wapl	UTSW	14	34731563	missense	probably benign	0.29
R9624:Wapl	UTSW	14	34692106	missense	possibly damaging	0.89
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCATGGTAATAGCACTCAC -3'
(R):5'- GTCATGATTAAAAGCTCTGGTTTGG -3'

Sequencing Primer
(F):5'- AGCACTCACTGTTTTTGGTCTAAG -3'
(R):5'- TGTTGTTTAGTTTCTGAGATTGGGTC -3'

Posted On

2018-11-06