Incidental Mutation 'R6937:Ugt3a1'
ID540360
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9292072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 97 (D97V)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861] [ENSMUST00000176878]
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: D97V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: D97V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176878
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGCTATGTCTTTACATGAAAGG -3'
(R):5'- AGGTATGAGTCAACTACCATGC -3'

Sequencing Primer
(F):5'- TTCCACAAAGAGGAGACATTAATTG -3'
(R):5'- GTATGAGTCAACTACCATGCACAATC -3'
Posted On2018-11-06