Incidental Mutation 'R6937:Ugt3a1'
ID 540360
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms Ugt3a2
MMRRC Submission 045051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6937 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 9335670-9370960 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9292158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 97 (D97V)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861] [ENSMUST00000176878]
AlphaFold Q3UP75
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: D97V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: D97V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176878
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,222,889 (GRCm39) V613A probably benign Het
Cdh23 A T 10: 60,322,893 (GRCm39) L337Q probably damaging Het
Chrna6 A G 8: 27,897,055 (GRCm39) L274P probably damaging Het
Ciita G A 16: 10,330,355 (GRCm39) probably null Het
Csnka2ip A T 16: 64,299,058 (GRCm39) probably benign Het
Ddx60 G A 8: 62,490,103 (GRCm39) D1691N probably damaging Het
Dnah7b T C 1: 46,234,280 (GRCm39) I1441T probably damaging Het
Dock4 T C 12: 40,884,634 (GRCm39) S1713P probably benign Het
Ep400 T C 5: 110,859,018 (GRCm39) probably benign Het
Epn1 T C 7: 5,092,943 (GRCm39) I85T probably damaging Het
Eri2 T C 7: 119,386,012 (GRCm39) K228E probably damaging Het
Garem1 C T 18: 21,280,827 (GRCm39) A510T probably benign Het
Gfm2 T A 13: 97,299,572 (GRCm39) probably null Het
Hnrnpd T C 5: 100,111,629 (GRCm39) T321A probably benign Het
Htr2a A T 14: 74,882,604 (GRCm39) I197F probably damaging Het
Krtap2-4 T A 11: 99,505,299 (GRCm39) probably benign Het
Lcn3 C A 2: 25,657,823 (GRCm39) Y179* probably null Het
Mak A T 13: 41,201,578 (GRCm39) M261K probably damaging Het
Marchf7 A G 2: 60,071,310 (GRCm39) T605A probably damaging Het
Mcm4 A C 16: 15,454,199 (GRCm39) F83V probably benign Het
Myo18b T C 5: 112,950,258 (GRCm39) N1546S probably benign Het
Nckap1 T A 2: 80,339,060 (GRCm39) K989N probably damaging Het
Ndufaf5 A G 2: 140,023,522 (GRCm39) D119G probably damaging Het
Or7g28 A T 9: 19,271,985 (GRCm39) V222D probably damaging Het
Pcdh1 T C 18: 38,336,528 (GRCm39) T36A possibly damaging Het
Pitpna C T 11: 75,494,557 (GRCm39) T100I possibly damaging Het
Pmf1 A T 3: 88,306,496 (GRCm39) L102Q probably damaging Het
Rftn2 T C 1: 55,233,508 (GRCm39) probably null Het
Robo3 A G 9: 37,341,176 (GRCm39) L10P probably benign Het
Serpinb6a T C 13: 34,102,801 (GRCm39) I241V possibly damaging Het
St14 A T 9: 31,040,956 (GRCm39) probably null Het
Stat6 T C 10: 127,494,571 (GRCm39) probably null Het
Tdpoz6 T C 3: 93,599,523 (GRCm39) N282S probably benign Het
Tdpoz8 A G 3: 92,981,417 (GRCm39) H145R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tgfbrap1 A T 1: 43,091,064 (GRCm39) V687E probably damaging Het
Trim30d A T 7: 104,132,634 (GRCm39) S68T probably damaging Het
Ttn A G 2: 76,663,253 (GRCm39) probably benign Het
Ugt8a G A 3: 125,709,250 (GRCm39) probably benign Het
Vmn1r184 A T 7: 25,966,750 (GRCm39) K165N probably benign Het
Vmn2r86 T A 10: 130,284,523 (GRCm39) I523F probably damaging Het
Wapl G A 14: 34,444,311 (GRCm39) V588I probably benign Het
Wdr7 C T 18: 63,924,938 (GRCm39) P974S probably benign Het
Zfp975 T C 7: 42,314,480 (GRCm39) D31G possibly damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9,310,698 (GRCm39) missense probably damaging 1.00
IGL01109:Ugt3a1 APN 15 9,367,354 (GRCm39) missense probably damaging 0.99
IGL01131:Ugt3a1 APN 15 9,365,248 (GRCm39) missense probably damaging 1.00
IGL01627:Ugt3a1 APN 15 9,335,806 (GRCm39) missense probably damaging 1.00
IGL01746:Ugt3a1 APN 15 9,361,754 (GRCm39) missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9,306,232 (GRCm39) missense probably damaging 1.00
IGL01949:Ugt3a1 APN 15 9,335,815 (GRCm39) missense probably damaging 1.00
IGL02213:Ugt3a1 APN 15 9,370,310 (GRCm39) missense probably benign 0.00
IGL02407:Ugt3a1 APN 15 9,365,316 (GRCm39) nonsense probably null
IGL02438:Ugt3a1 APN 15 9,292,062 (GRCm39) missense possibly damaging 0.90
IGL02588:Ugt3a1 APN 15 9,361,542 (GRCm39) missense probably benign
IGL02894:Ugt3a1 APN 15 9,367,487 (GRCm39) missense probably damaging 1.00
IGL02966:Ugt3a1 APN 15 9,370,154 (GRCm39) missense probably damaging 1.00
IGL03385:Ugt3a1 APN 15 9,338,824 (GRCm39) missense probably damaging 0.99
IGL03493:Ugt3a1 APN 15 9,361,569 (GRCm39) missense probably damaging 0.96
PIT4354001:Ugt3a1 UTSW 15 9,306,446 (GRCm39) nonsense probably null
R0127:Ugt3a1 UTSW 15 9,306,342 (GRCm39) missense probably benign 0.01
R0554:Ugt3a1 UTSW 15 9,351,206 (GRCm39) missense probably benign 0.14
R0647:Ugt3a1 UTSW 15 9,310,635 (GRCm39) missense probably benign 0.00
R0833:Ugt3a1 UTSW 15 9,370,236 (GRCm39) missense probably damaging 0.96
R0841:Ugt3a1 UTSW 15 9,306,214 (GRCm39) missense probably benign 0.07
R1071:Ugt3a1 UTSW 15 9,367,454 (GRCm39) missense possibly damaging 0.82
R1395:Ugt3a1 UTSW 15 9,306,378 (GRCm39) missense possibly damaging 0.92
R1513:Ugt3a1 UTSW 15 9,361,610 (GRCm39) missense probably benign 0.07
R1616:Ugt3a1 UTSW 15 9,306,330 (GRCm39) nonsense probably null
R1844:Ugt3a1 UTSW 15 9,351,254 (GRCm39) missense probably benign 0.07
R1874:Ugt3a1 UTSW 15 9,365,437 (GRCm39) missense probably damaging 1.00
R2305:Ugt3a1 UTSW 15 9,351,203 (GRCm39) missense probably benign
R2338:Ugt3a1 UTSW 15 9,292,059 (GRCm39) splice site probably benign
R3052:Ugt3a1 UTSW 15 9,365,374 (GRCm39) missense probably damaging 1.00
R3755:Ugt3a1 UTSW 15 9,367,498 (GRCm39) missense probably benign 0.21
R3797:Ugt3a1 UTSW 15 9,310,727 (GRCm39) nonsense probably null
R3945:Ugt3a1 UTSW 15 9,370,184 (GRCm39) missense possibly damaging 0.91
R4135:Ugt3a1 UTSW 15 9,338,810 (GRCm39) missense probably damaging 0.98
R4261:Ugt3a1 UTSW 15 9,335,879 (GRCm39) splice site probably null
R4305:Ugt3a1 UTSW 15 9,306,360 (GRCm39) missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9,306,565 (GRCm39) missense probably benign 0.15
R4438:Ugt3a1 UTSW 15 9,351,283 (GRCm39) missense probably benign 0.01
R4570:Ugt3a1 UTSW 15 9,338,807 (GRCm39) missense probably benign 0.12
R4572:Ugt3a1 UTSW 15 9,306,479 (GRCm39) missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9,306,486 (GRCm39) nonsense probably null
R4744:Ugt3a1 UTSW 15 9,310,639 (GRCm39) missense probably benign 0.36
R4791:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R4957:Ugt3a1 UTSW 15 9,365,274 (GRCm39) missense probably benign 0.27
R5011:Ugt3a1 UTSW 15 9,365,373 (GRCm39) missense probably damaging 1.00
R5035:Ugt3a1 UTSW 15 9,361,704 (GRCm39) missense probably benign 0.01
R5554:Ugt3a1 UTSW 15 9,370,287 (GRCm39) missense probably damaging 1.00
R5573:Ugt3a1 UTSW 15 9,361,769 (GRCm39) missense probably damaging 1.00
R5631:Ugt3a1 UTSW 15 9,361,971 (GRCm39) missense probably damaging 0.98
R5696:Ugt3a1 UTSW 15 9,361,534 (GRCm39) splice site silent
R5715:Ugt3a1 UTSW 15 9,306,430 (GRCm39) missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9,310,762 (GRCm39) missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9,310,726 (GRCm39) missense possibly damaging 0.81
R6265:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R6302:Ugt3a1 UTSW 15 9,365,397 (GRCm39) missense probably damaging 1.00
R6311:Ugt3a1 UTSW 15 9,361,604 (GRCm39) nonsense probably null
R6344:Ugt3a1 UTSW 15 9,306,317 (GRCm39) missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6680:Ugt3a1 UTSW 15 9,370,154 (GRCm39) missense probably damaging 1.00
R6737:Ugt3a1 UTSW 15 9,311,895 (GRCm39) missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9,280,138 (GRCm39) splice site probably null
R7061:Ugt3a1 UTSW 15 9,306,240 (GRCm39) missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9,310,779 (GRCm39) nonsense probably null
R7840:Ugt3a1 UTSW 15 9,311,903 (GRCm39) missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9,284,261 (GRCm39) critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9,306,476 (GRCm39) missense probably benign 0.00
R8229:Ugt3a1 UTSW 15 9,367,463 (GRCm39) missense probably damaging 0.99
R8296:Ugt3a1 UTSW 15 9,362,024 (GRCm39) missense probably benign 0.18
R8414:Ugt3a1 UTSW 15 9,310,669 (GRCm39) missense possibly damaging 0.82
R8809:Ugt3a1 UTSW 15 9,367,345 (GRCm39) missense possibly damaging 0.69
R8981:Ugt3a1 UTSW 15 9,312,014 (GRCm39) missense probably benign 0.20
R9066:Ugt3a1 UTSW 15 9,367,384 (GRCm39) missense possibly damaging 0.94
R9071:Ugt3a1 UTSW 15 9,370,224 (GRCm39) nonsense probably null
R9111:Ugt3a1 UTSW 15 9,306,333 (GRCm39) missense possibly damaging 0.69
R9151:Ugt3a1 UTSW 15 9,362,051 (GRCm39) missense probably benign 0.03
R9451:Ugt3a1 UTSW 15 9,292,158 (GRCm39) missense probably benign 0.00
R9522:Ugt3a1 UTSW 15 9,370,209 (GRCm39) missense probably damaging 1.00
R9567:Ugt3a1 UTSW 15 9,306,370 (GRCm39) missense possibly damaging 0.82
R9609:Ugt3a1 UTSW 15 9,361,905 (GRCm39) missense probably damaging 1.00
R9657:Ugt3a1 UTSW 15 9,280,133 (GRCm39) missense probably damaging 0.98
Z1177:Ugt3a1 UTSW 15 9,367,343 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTAGCTATGTCTTTACATGAAAGG -3'
(R):5'- AGGTATGAGTCAACTACCATGC -3'

Sequencing Primer
(F):5'- TTCCACAAAGAGGAGACATTAATTG -3'
(R):5'- GTATGAGTCAACTACCATGCACAATC -3'
Posted On 2018-11-06