Incidental Mutation 'R6937:Mcm4'
ID540361
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Nameminichromosome maintenance complex component 4
SynonymsmCdc21, 19G, Cdc21, Mcmd4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location15623897-15637400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 15636335 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 83 (F83V)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352] [ENSMUST00000023353]
Predicted Effect probably benign
Transcript: ENSMUST00000023352
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023353
AA Change: F83V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: F83V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229606
Predicted Effect probably benign
Transcript: ENSMUST00000230437
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15626131 missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15630420 missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15624738 missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15636713 missense probably benign 0.01
R0200:Mcm4 UTSW 16 15629639 missense probably benign 0.41
R0540:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R0607:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R2064:Mcm4 UTSW 16 15634469 missense possibly damaging 0.75
R4240:Mcm4 UTSW 16 15627706 nonsense probably null
R4604:Mcm4 UTSW 16 15629663 missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15634510 nonsense probably null
R5070:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5178:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5245:Mcm4 UTSW 16 15630425 missense probably benign 0.02
R5513:Mcm4 UTSW 16 15630514 missense probably benign 0.26
R5696:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15630409 missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15629362 missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15628697 missense probably damaging 1.00
R7402:Mcm4 UTSW 16 15637178 start codon destroyed probably null
R7483:Mcm4 UTSW 16 15630442 missense probably benign 0.05
R8275:Mcm4 UTSW 16 15634571 missense probably damaging 0.98
Z1177:Mcm4 UTSW 16 15629454 missense probably damaging 1.00
Z1177:Mcm4 UTSW 16 15632216 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGGTAACACCATCAGAGATCTGC -3'
(R):5'- TCACTGAAACACCTGAGGAGAG -3'

Sequencing Primer
(F):5'- AGAGATCTGCTTTGTACTCACG -3'
(R):5'- AGCAGAGTTGGTACATTTTAGGACC -3'
Posted On2018-11-06