Incidental Mutation 'R6938:Gbp4'
ID540378
Institutional Source Beutler Lab
Gene Symbol Gbp4
Ensembl Gene ENSMUSG00000079363
Gene Nameguanylate binding protein 4
SynonymsMpa2, Mag-2, Mpa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105115767-105139586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105135077 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000142493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000100961] [ENSMUST00000100962] [ENSMUST00000196204] [ENSMUST00000196677] [ENSMUST00000197799] [ENSMUST00000199629]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100962
AA Change: D109G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098522
Gene: ENSMUSG00000079363
AA Change: D109G

DomainStartEndE-ValueType
Pfam:GBP 16 287 4.2e-91 PFAM
Pfam:GBP_C 289 583 4.4e-117 PFAM
Predicted Effect silent
Transcript: ENSMUST00000196204
SMART Domains Protein: ENSMUSP00000142528
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 16 76 1e-19 PFAM
low complexity region 82 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196677
SMART Domains Protein: ENSMUSP00000142795
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 149 3e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197799
AA Change: D109G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142493
Gene: ENSMUSG00000079363
AA Change: D109G

DomainStartEndE-ValueType
Pfam:GBP 16 184 3.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199629
SMART Domains Protein: ENSMUSP00000143689
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 127 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Asxl2 G C 12: 3,476,149 R255T probably damaging Het
Btg3 T C 16: 78,360,328 I244V probably benign Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mex3d T C 10: 80,382,240 N381S possibly damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plbd1 T C 6: 136,616,987 I377V probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Tmem231 T C 8: 111,933,512 S53G probably damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Gbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Gbp4 APN 5 105137021 start codon destroyed probably null 0.00
IGL01834:Gbp4 APN 5 105125602 missense probably damaging 1.00
IGL02100:Gbp4 APN 5 105122075 unclassified probably benign
IGL02119:Gbp4 APN 5 105121042 missense probably benign 0.14
IGL02364:Gbp4 APN 5 105136874 missense probably damaging 1.00
IGL03026:Gbp4 APN 5 105120000 missense possibly damaging 0.88
PIT4651001:Gbp4 UTSW 5 105118423 missense probably benign 0.08
R0147:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0148:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0413:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0415:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0478:Gbp4 UTSW 5 105119433 missense probably benign 0.01
R0546:Gbp4 UTSW 5 105120970 missense probably damaging 1.00
R0638:Gbp4 UTSW 5 105121840 missense probably damaging 0.98
R1528:Gbp4 UTSW 5 105121792 splice site probably null
R1541:Gbp4 UTSW 5 105118409 missense probably benign
R2099:Gbp4 UTSW 5 105121081 missense probably damaging 1.00
R2112:Gbp4 UTSW 5 105135176 missense possibly damaging 0.95
R2994:Gbp4 UTSW 5 105137020 start codon destroyed probably null 0.86
R4021:Gbp4 UTSW 5 105120923 missense probably damaging 0.96
R4258:Gbp4 UTSW 5 105136975 missense probably damaging 1.00
R4489:Gbp4 UTSW 5 105121907 missense probably damaging 1.00
R5164:Gbp4 UTSW 5 105136877 nonsense probably null
R5195:Gbp4 UTSW 5 105119532 missense probably benign 0.00
R5406:Gbp4 UTSW 5 105119521 missense possibly damaging 0.76
R5550:Gbp4 UTSW 5 105122045 missense probably damaging 1.00
R5701:Gbp4 UTSW 5 105118399 missense possibly damaging 0.60
R5814:Gbp4 UTSW 5 105119919 missense probably benign 0.27
R6128:Gbp4 UTSW 5 105135164 missense possibly damaging 0.93
R6307:Gbp4 UTSW 5 105123109 nonsense probably null
R6513:Gbp4 UTSW 5 105123120 missense possibly damaging 0.69
R6870:Gbp4 UTSW 5 105125578 missense probably damaging 1.00
R7063:Gbp4 UTSW 5 105118448 missense probably damaging 0.96
R7124:Gbp4 UTSW 5 105119959 missense possibly damaging 0.45
R7457:Gbp4 UTSW 5 105119553 missense probably damaging 0.98
R7615:Gbp4 UTSW 5 105122982 missense possibly damaging 0.95
R7877:Gbp4 UTSW 5 105118295 missense probably benign 0.34
R7905:Gbp4 UTSW 5 105121087 missense probably damaging 1.00
R8274:Gbp4 UTSW 5 105119472 missense probably benign 0.01
R8377:Gbp4 UTSW 5 105118462 missense probably benign 0.02
R8414:Gbp4 UTSW 5 105136837 missense probably benign 0.05
R8423:Gbp4 UTSW 5 105119934 missense probably damaging 1.00
S24628:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
X0067:Gbp4 UTSW 5 105125625 missense probably damaging 0.98
Z1088:Gbp4 UTSW 5 105120997 missense probably damaging 1.00
Z1177:Gbp4 UTSW 5 105119449 nonsense probably null
Z1177:Gbp4 UTSW 5 105125135 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- TCACACTGAATCAAATCATTTGCCC -3'
(R):5'- GCTTGGCACCGAGGTTTTAG -3'

Sequencing Primer
(F):5'- CCCAAATGGCAAGAAATAAAAGCATG -3'
(R):5'- GGTTTTAGCACACAAGGCC -3'
Posted On2018-11-06