Incidental Mutation 'R6938:Plbd1'
ID540382
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136616987 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 377 (I377V)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032336]
Predicted Effect probably benign
Transcript: ENSMUST00000032336
AA Change: I377V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: I377V

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Asxl2 G C 12: 3,476,149 R255T probably damaging Het
Btg3 T C 16: 78,360,328 I244V probably benign Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gbp4 T C 5: 105,135,077 D109G probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mex3d T C 10: 80,382,240 N381S possibly damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Tmem231 T C 8: 111,933,512 S53G probably damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1019:Plbd1 UTSW 6 136651905 missense probably benign 0.03
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R2909:Plbd1 UTSW 6 136634574 missense probably damaging 1.00
R4494:Plbd1 UTSW 6 136613858 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6842:Plbd1 UTSW 6 136635614 missense probably benign 0.05
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
R7654:Plbd1 UTSW 6 136651866 missense possibly damaging 0.47
R7744:Plbd1 UTSW 6 136617246 missense probably benign 0.00
R7870:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
R7953:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTTTACCAGGATGCCCGTC -3'
(R):5'- GTGCCTATGTCTAGCCTTACAG -3'

Sequencing Primer
(F):5'- AAGTGGTGTCATAGTAGCTCACCC -3'
(R):5'- GCCTTACAGTTGTTAATCAGTTGACG -3'
Posted On2018-11-06