Incidental Mutation 'R6938:Tmem231'
ID540387
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Nametransmembrane protein 231
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111912011-111933881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111933512 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 53 (S53G)
Ref Sequence ENSEMBL: ENSMUSP00000148428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034429
AA Change: S53G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951
AA Change: S53G

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211866
AA Change: S53G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Asxl2 G C 12: 3,476,149 R255T probably damaging Het
Btg3 T C 16: 78,360,328 I244V probably benign Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gbp4 T C 5: 105,135,077 D109G probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mex3d T C 10: 80,382,240 N381S possibly damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plbd1 T C 6: 136,616,987 I377V probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 111918440 splice site probably benign
IGL02800:Tmem231 APN 8 111914032 missense probably benign 0.03
R2281:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R2306:Tmem231 UTSW 8 111918871 missense probably damaging 1.00
R3615:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 111914592 missense probably benign 0.02
R4708:Tmem231 UTSW 8 111933786 start gained probably benign
R5522:Tmem231 UTSW 8 111918410 missense possibly damaging 0.92
R6266:Tmem231 UTSW 8 111915265 missense probably null 0.71
R6414:Tmem231 UTSW 8 111926892 intron probably benign
R6415:Tmem231 UTSW 8 111926892 intron probably benign
R6418:Tmem231 UTSW 8 111926892 intron probably benign
R6419:Tmem231 UTSW 8 111926892 intron probably benign
R6622:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R7103:Tmem231 UTSW 8 111918885 synonymous probably null
R7221:Tmem231 UTSW 8 111933676 missense probably benign
R7305:Tmem231 UTSW 8 111915295 missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 111918408 missense probably damaging 1.00
R7781:Tmem231 UTSW 8 111918290 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACTGGGATCTCACTCCATC -3'
(R):5'- TCATGGCGCTGTACCATCTC -3'

Sequencing Primer
(F):5'- AAACTGGGATCTCACTCCATCCTATC -3'
(R):5'- AATCGAGCGCGCTTACC -3'
Posted On2018-11-06