Incidental Mutation 'R6938:Mex3d'
ID540393
Institutional Source Beutler Lab
Gene Symbol Mex3d
Ensembl Gene ENSMUSG00000048696
Gene Namemex3 RNA binding family member D
SynonymsRkhd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80380355-80387659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80382240 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 381 (N381S)
Ref Sequence ENSEMBL: ENSMUSP00000100987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105350]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105350
AA Change: N381S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100987
Gene: ENSMUSG00000048696
AA Change: N381S

DomainStartEndE-ValueType
internal_repeat_2 3 25 3.12e-8 PROSPERO
internal_repeat_1 5 34 7.48e-13 PROSPERO
internal_repeat_1 41 70 7.48e-13 PROSPERO
internal_repeat_2 51 73 3.12e-8 PROSPERO
low complexity region 78 94 N/A INTRINSIC
KH 125 193 6.8e-10 SMART
KH 220 287 4.45e-14 SMART
low complexity region 356 388 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
low complexity region 535 557 N/A INTRINSIC
RING 560 599 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123141
SMART Domains Protein: ENSMUSP00000115410
Gene: ENSMUSG00000048696

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
low complexity region 178 200 N/A INTRINSIC
RING 203 242 7.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Asxl2 G C 12: 3,476,149 R255T probably damaging Het
Btg3 T C 16: 78,360,328 I244V probably benign Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gbp4 T C 5: 105,135,077 D109G probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plbd1 T C 6: 136,616,987 I377V probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Tmem231 T C 8: 111,933,512 S53G probably damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Mex3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Mex3d APN 10 80382035 missense possibly damaging 0.49
R0316:Mex3d UTSW 10 80381671 missense probably damaging 0.97
R0401:Mex3d UTSW 10 80386894 missense probably benign 0.33
R0734:Mex3d UTSW 10 80381532 missense possibly damaging 0.55
R0894:Mex3d UTSW 10 80381542 missense probably benign 0.04
R1452:Mex3d UTSW 10 80381520 missense probably damaging 0.99
R1764:Mex3d UTSW 10 80386936 missense probably benign 0.15
R1795:Mex3d UTSW 10 80381542 missense probably benign 0.04
R4801:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R4802:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R5632:Mex3d UTSW 10 80382594 missense probably damaging 1.00
R5701:Mex3d UTSW 10 80381545 missense probably benign 0.00
R5964:Mex3d UTSW 10 80382587 missense probably damaging 1.00
R6133:Mex3d UTSW 10 80386786 missense probably damaging 0.99
R6414:Mex3d UTSW 10 80381371 missense unknown
R7154:Mex3d UTSW 10 80386750 missense
R7241:Mex3d UTSW 10 80387257 missense
R7463:Mex3d UTSW 10 80381698 missense
Z1176:Mex3d UTSW 10 80386713 missense
Z1177:Mex3d UTSW 10 80381350 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGTCACAGTCCTCTGGGG -3'
(R):5'- CTAATCCGAGCCACACGTAG -3'

Sequencing Primer
(F):5'- ATGTGAAGCCCCCATTGC -3'
(R):5'- CGAGCCACACGTAGCAAGG -3'
Posted On2018-11-06