Mutagenetix > Incidental Mutations

Incidental Mutation 'R6938:Asxl2'

540397

Institutional Source

Beutler Lab

Gene Symbol

Asxl2

Ensembl Gene

ENSMUSG00000037486

Gene Name

additional sex combs like 2, transcriptional regulator

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R6938 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3426857-3506852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 3476149 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Threonine at position 255 (R255T)

Ref Sequence

ENSEMBL: ENSMUSP00000116048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]

Predicted Effect

probably benign
Transcript: ENSMUST00000092003

SMART Domains

Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.2e-22	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	204	336	1.2e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111215

SMART Domains

Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	3.6e-22	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	204	336	4.2e-52	PFAM
low complexity region	614	637	N/A	INTRINSIC
low complexity region	640	658	N/A	INTRINSIC
low complexity region	849	870	N/A	INTRINSIC
low complexity region	1115	1124	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
Pfam:PHD_3	1305	1368	1.1e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138740

SMART Domains

Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	1	54	1.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144247
AA Change: R255T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486
AA Change: R255T

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	5.2e-23	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
low complexity region	221	244	N/A	INTRINSIC
Pfam:ASXH	252	384	7e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153102

SMART Domains

Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-23	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	211	335	6.9e-38	PFAM
low complexity region	614	637	N/A	INTRINSIC
low complexity region	640	658	N/A	INTRINSIC
low complexity region	849	870	N/A	INTRINSIC
low complexity region	1115	1124	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
Pfam:PHD_3	1308	1368	7.6e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	C	2: 130,775,753	H297Q	probably benign	Het
Acot7	T	C	4: 152,217,894		probably null	Het
Acp6	T	C	3: 97,175,633	M320T	probably benign	Het
Adam22	A	T	5: 8,146,499	Y259N	probably benign	Het
Akap9	C	A	5: 4,046,628	A2501D	possibly damaging	Het
Angpt2	G	T	8: 18,698,089	S385*	probably null	Het
Btg3	T	C	16: 78,360,328	I244V	probably benign	Het
Casr	T	C	16: 36,495,921	T596A	probably damaging	Het
Ccl1	A	T	11: 82,176,858	V82D	probably damaging	Het
Col18a1	T	A	10: 77,112,499		probably benign	Het
Crybg1	T	C	10: 43,997,383	D1243G	probably benign	Het
Drc3	A	T	11: 60,394,123		probably null	Het
Enpep	T	C	3: 129,298,950	D528G	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gbp4	T	C	5: 105,135,077	D109G	probably damaging	Het
Gstz1	A	G	12: 87,147,169		probably null	Het
Kctd10	C	A	5: 114,370,130	E106*	probably null	Het
Kctd20	G	A	17: 28,961,581	G110S	probably benign	Het
Klk1b26	A	T	7: 44,016,294	T177S	probably benign	Het
Kyat3	T	A	3: 142,725,422	V118E	probably damaging	Het
Maml3	T	C	3: 52,103,738	K136E	probably damaging	Het
Mex3d	T	C	10: 80,382,240	N381S	possibly damaging	Het
Mmrn2	A	T	14: 34,398,714	T514S	probably benign	Het
Nlrp1b	G	A	11: 71,218,216	A153V	probably damaging	Het
Olfr70	C	T	4: 43,696,286	V296M	probably damaging	Het
Pcolce	T	C	5: 137,605,616	T365A	probably benign	Het
Plbd1	T	C	6: 136,616,987	I377V	probably benign	Het
Plk2	T	A	13: 110,396,680	Y192*	probably null	Het
Rev3l	T	A	10: 39,862,710	V2820D	probably damaging	Het
Secisbp2l	G	T	2: 125,750,352	P650T	probably damaging	Het
Slc9a5	T	C	8: 105,353,432	L69P	probably damaging	Het
Sp9	T	C	2: 73,273,272	C57R	probably damaging	Het
Tbl3	A	T	17: 24,705,213	V190D	possibly damaging	Het
Timm8b	A	G	9: 50,604,994	D49G	possibly damaging	Het
Tmem231	T	C	8: 111,933,512	S53G	probably damaging	Het
Topbp1	T	A	9: 103,328,554	V797D	probably damaging	Het
Trip11	A	T	12: 101,837,627	D1665E	probably damaging	Het
Txk	C	A	5: 72,699,149	R433L	probably damaging	Het
Vmn1r19	T	C	6: 57,405,007	S182P	possibly damaging	Het
Vps13b	T	G	15: 35,423,198	I221M	probably damaging	Het
Xpo7	T	C	14: 70,666,024	N1082D	probably benign	Het

Other mutations in Asxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Asxl2	APN	12	3474560	missense	probably damaging	1.00
IGL01301:Asxl2	APN	12	3501425	missense	probably damaging	1.00
IGL01325:Asxl2	APN	12	3427172	missense	probably damaging	0.98
IGL01689:Asxl2	APN	12	3496425	missense	probably benign	0.28
IGL01871:Asxl2	APN	12	3502112	missense	probably benign	0.38
IGL02164:Asxl2	APN	12	3502079	missense	probably benign	0.00
IGL02609:Asxl2	APN	12	3500018	missense	probably damaging	1.00
IGL03191:Asxl2	APN	12	3500094	missense	probably damaging	1.00
Blinder	UTSW	12	3442529	missense	probably damaging	0.99
Fob	UTSW	12	3484531	missense	probably damaging	1.00
peaky	UTSW	12	3476040	missense	possibly damaging	0.91
ANU18:Asxl2	UTSW	12	3501425	missense	probably damaging	1.00
R0092:Asxl2	UTSW	12	3496313	missense	probably benign	0.00
R0118:Asxl2	UTSW	12	3496923	missense	probably damaging	1.00
R0277:Asxl2	UTSW	12	3442487	missense	probably damaging	1.00
R0323:Asxl2	UTSW	12	3442487	missense	probably damaging	1.00
R0584:Asxl2	UTSW	12	3496632	missense	probably damaging	0.96
R0885:Asxl2	UTSW	12	3501458	missense	probably damaging	1.00
R1344:Asxl2	UTSW	12	3493790	missense	probably damaging	1.00
R1456:Asxl2	UTSW	12	3501872	missense	possibly damaging	0.70
R1829:Asxl2	UTSW	12	3457125	missense	probably damaging	1.00
R1909:Asxl2	UTSW	12	3474577	missense	probably damaging	1.00
R1990:Asxl2	UTSW	12	3484558	nonsense	probably null
R2074:Asxl2	UTSW	12	3493779	missense	probably damaging	1.00
R2883:Asxl2	UTSW	12	3501830	missense	probably benign	0.03
R2912:Asxl2	UTSW	12	3474517	missense	probably benign	0.06
R4446:Asxl2	UTSW	12	3501774	missense	possibly damaging	0.54
R4662:Asxl2	UTSW	12	3427193	missense	probably damaging	0.99
R4726:Asxl2	UTSW	12	3501872	missense	possibly damaging	0.70
R5034:Asxl2	UTSW	12	3502193	missense	probably damaging	0.98
R5287:Asxl2	UTSW	12	3496893	missense	probably benign	0.02
R5377:Asxl2	UTSW	12	3474618	splice site	probably null
R5611:Asxl2	UTSW	12	3484598	missense	probably damaging	1.00
R5708:Asxl2	UTSW	12	3500603	missense	possibly damaging	0.82
R5945:Asxl2	UTSW	12	3500439	missense	possibly damaging	0.82
R6154:Asxl2	UTSW	12	3496593	missense	possibly damaging	0.60
R6288:Asxl2	UTSW	12	3476040	missense	possibly damaging	0.91
R6405:Asxl2	UTSW	12	3493758	missense	probably damaging	0.99
R7146:Asxl2	UTSW	12	3457066	missense	probably damaging	1.00
R7354:Asxl2	UTSW	12	3455637	intron	probably benign
R7396:Asxl2	UTSW	12	3442529	missense	probably damaging	0.99
R7438:Asxl2	UTSW	12	3427108	start gained	probably benign
R7980:Asxl2	UTSW	12	3496630	missense	probably damaging	0.99
R7991:Asxl2	UTSW	12	3484531	missense	probably damaging	1.00
R8063:Asxl2	UTSW	12	3500768	missense	probably benign	0.01
R8156:Asxl2	UTSW	12	3496760	missense	probably benign	0.09
R8396:Asxl2	UTSW	12	3502220	missense	probably benign
R8773:Asxl2	UTSW	12	3457200	missense	probably damaging	0.97
Z1177:Asxl2	UTSW	12	3474589	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTGTATGCGCCTCTGTCAC -3'
(R):5'- GTGTAGACCAAGTCCCTAGC -3'

Sequencing Primer
(F):5'- ATGCGCCTCTGTCACCAGTC -3'
(R):5'- TCTATGAGTTCAAGGCCAGC -3'

Posted On

2018-11-06