Incidental Mutation 'R6938:Asxl2'
ID540397
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 3476149 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 255 (R255T)
Ref Sequence ENSEMBL: ENSMUSP00000116048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]
Predicted Effect probably benign
Transcript: ENSMUST00000092003
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111215
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138740
SMART Domains Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 1 54 1.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144247
AA Change: R255T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486
AA Change: R255T

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 5.2e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
low complexity region 221 244 N/A INTRINSIC
Pfam:ASXH 252 384 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153102
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Btg3 T C 16: 78,360,328 I244V probably benign Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gbp4 T C 5: 105,135,077 D109G probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mex3d T C 10: 80,382,240 N381S possibly damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plbd1 T C 6: 136,616,987 I377V probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Tmem231 T C 8: 111,933,512 S53G probably damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0584:Asxl2 UTSW 12 3496632 missense probably damaging 0.96
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2883:Asxl2 UTSW 12 3501830 missense probably benign 0.03
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5611:Asxl2 UTSW 12 3484598 missense probably damaging 1.00
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6405:Asxl2 UTSW 12 3493758 missense probably damaging 0.99
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R7438:Asxl2 UTSW 12 3427108 start gained probably benign
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGTATGCGCCTCTGTCAC -3'
(R):5'- GTGTAGACCAAGTCCCTAGC -3'

Sequencing Primer
(F):5'- ATGCGCCTCTGTCACCAGTC -3'
(R):5'- TCTATGAGTTCAAGGCCAGC -3'
Posted On2018-11-06