Incidental Mutation 'R6938:Trip11'
ID 540399
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Name thyroid hormone receptor interactor 11
Synonyms 3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik
MMRRC Submission 045052-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6938 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 101800304-101879463 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101803886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1665 (D1665E)
Ref Sequence ENSEMBL: ENSMUSP00000134976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]
AlphaFold E9Q512
Predicted Effect probably damaging
Transcript: ENSMUST00000021605
AA Change: D1950E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: D1950E

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177183
AA Change: D1665E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: D1665E

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,302,351 (GRCm39) probably null Het
Acp6 T C 3: 97,082,949 (GRCm39) M320T probably benign Het
Adam22 A T 5: 8,196,499 (GRCm39) Y259N probably benign Het
Akap9 C A 5: 4,096,628 (GRCm39) A2501D possibly damaging Het
Angpt2 G T 8: 18,748,105 (GRCm39) S385* probably null Het
Asxl2 G C 12: 3,526,149 (GRCm39) R255T probably damaging Het
Btg3 T C 16: 78,157,216 (GRCm39) I244V probably benign Het
Casr T C 16: 36,316,283 (GRCm39) T596A probably damaging Het
Ccl1 A T 11: 82,067,684 (GRCm39) V82D probably damaging Het
Col18a1 T A 10: 76,948,333 (GRCm39) probably benign Het
Crybg1 T C 10: 43,873,379 (GRCm39) D1243G probably benign Het
Dnaaf9 A C 2: 130,617,673 (GRCm39) H297Q probably benign Het
Drc3 A T 11: 60,284,949 (GRCm39) probably null Het
Enpep T C 3: 129,092,599 (GRCm39) D528G probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gbp4 T C 5: 105,282,943 (GRCm39) D109G probably damaging Het
Gstz1 A G 12: 87,193,943 (GRCm39) probably null Het
Kctd10 C A 5: 114,508,191 (GRCm39) E106* probably null Het
Kctd20 G A 17: 29,180,555 (GRCm39) G110S probably benign Het
Klk1b26 A T 7: 43,665,718 (GRCm39) T177S probably benign Het
Kyat3 T A 3: 142,431,183 (GRCm39) V118E probably damaging Het
Maml3 T C 3: 52,011,159 (GRCm39) K136E probably damaging Het
Mex3d T C 10: 80,218,074 (GRCm39) N381S possibly damaging Het
Mmrn2 A T 14: 34,120,671 (GRCm39) T514S probably benign Het
Nlrp1b G A 11: 71,109,042 (GRCm39) A153V probably damaging Het
Or13e8 C T 4: 43,696,286 (GRCm39) V296M probably damaging Het
Pcolce T C 5: 137,603,878 (GRCm39) T365A probably benign Het
Plbd1 T C 6: 136,593,985 (GRCm39) I377V probably benign Het
Plk2 T A 13: 110,533,214 (GRCm39) Y192* probably null Het
Rev3l T A 10: 39,738,706 (GRCm39) V2820D probably damaging Het
Secisbp2l G T 2: 125,592,272 (GRCm39) P650T probably damaging Het
Slc9a5 T C 8: 106,080,064 (GRCm39) L69P probably damaging Het
Sp9 T C 2: 73,103,616 (GRCm39) C57R probably damaging Het
Tbl3 A T 17: 24,924,187 (GRCm39) V190D possibly damaging Het
Timm8b A G 9: 50,516,294 (GRCm39) D49G possibly damaging Het
Tmem231 T C 8: 112,660,144 (GRCm39) S53G probably damaging Het
Topbp1 T A 9: 103,205,753 (GRCm39) V797D probably damaging Het
Txk C A 5: 72,856,492 (GRCm39) R433L probably damaging Het
Vmn1r19 T C 6: 57,381,992 (GRCm39) S182P possibly damaging Het
Vps13b T G 15: 35,423,344 (GRCm39) I221M probably damaging Het
Xpo7 T C 14: 70,903,464 (GRCm39) N1082D probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101,852,406 (GRCm39) missense probably benign 0.37
IGL00484:Trip11 APN 12 101,851,570 (GRCm39) nonsense probably null
IGL00972:Trip11 APN 12 101,860,596 (GRCm39) missense probably null 1.00
IGL01476:Trip11 APN 12 101,865,170 (GRCm39) missense probably damaging 0.96
IGL01591:Trip11 APN 12 101,849,604 (GRCm39) missense probably damaging 0.98
IGL01667:Trip11 APN 12 101,845,121 (GRCm39) missense probably damaging 1.00
IGL01764:Trip11 APN 12 101,850,890 (GRCm39) missense probably damaging 1.00
IGL01789:Trip11 APN 12 101,838,090 (GRCm39) missense probably benign 0.05
IGL01814:Trip11 APN 12 101,850,747 (GRCm39) missense probably damaging 0.98
IGL01898:Trip11 APN 12 101,851,935 (GRCm39) missense probably benign
IGL01924:Trip11 APN 12 101,853,143 (GRCm39) missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101,850,572 (GRCm39) missense probably damaging 1.00
IGL02475:Trip11 APN 12 101,861,942 (GRCm39) missense probably benign 0.01
IGL02544:Trip11 APN 12 101,859,780 (GRCm39) missense probably damaging 1.00
IGL02678:Trip11 APN 12 101,849,649 (GRCm39) missense probably damaging 0.96
IGL02714:Trip11 APN 12 101,850,260 (GRCm39) missense probably damaging 1.00
IGL02718:Trip11 APN 12 101,852,284 (GRCm39) missense probably benign 0.24
IGL02904:Trip11 APN 12 101,853,097 (GRCm39) missense probably damaging 1.00
IGL03012:Trip11 APN 12 101,850,195 (GRCm39) missense probably damaging 1.00
IGL03191:Trip11 APN 12 101,865,184 (GRCm39) missense probably damaging 1.00
IGL03327:Trip11 APN 12 101,849,677 (GRCm39) missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101,851,278 (GRCm39) missense probably damaging 1.00
NA:Trip11 UTSW 12 101,860,580 (GRCm39) splice site probably null
R0027:Trip11 UTSW 12 101,851,428 (GRCm39) missense probably benign 0.00
R0028:Trip11 UTSW 12 101,851,016 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0505:Trip11 UTSW 12 101,851,931 (GRCm39) missense probably damaging 0.98
R0556:Trip11 UTSW 12 101,850,777 (GRCm39) nonsense probably null
R0573:Trip11 UTSW 12 101,853,119 (GRCm39) missense probably benign 0.02
R0626:Trip11 UTSW 12 101,852,235 (GRCm39) missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101,852,419 (GRCm39) missense probably benign 0.04
R1530:Trip11 UTSW 12 101,879,026 (GRCm39) missense unknown
R1647:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1648:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1856:Trip11 UTSW 12 101,849,592 (GRCm39) nonsense probably null
R2013:Trip11 UTSW 12 101,803,981 (GRCm39) missense probably damaging 1.00
R2017:Trip11 UTSW 12 101,851,619 (GRCm39) missense probably benign 0.00
R2206:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2207:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2304:Trip11 UTSW 12 101,865,236 (GRCm39) missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101,845,086 (GRCm39) makesense probably null
R2513:Trip11 UTSW 12 101,803,986 (GRCm39) missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101,859,953 (GRCm39) missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101,860,581 (GRCm39) nonsense probably null
R4124:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4126:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4128:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4175:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4176:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4181:Trip11 UTSW 12 101,860,027 (GRCm39) missense probably damaging 1.00
R4296:Trip11 UTSW 12 101,852,127 (GRCm39) nonsense probably null
R4302:Trip11 UTSW 12 101,860,027 (GRCm39) missense probably damaging 1.00
R4306:Trip11 UTSW 12 101,853,198 (GRCm39) missense probably benign
R4342:Trip11 UTSW 12 101,850,575 (GRCm39) missense probably damaging 1.00
R4576:Trip11 UTSW 12 101,852,499 (GRCm39) nonsense probably null
R4586:Trip11 UTSW 12 101,849,600 (GRCm39) missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101,803,875 (GRCm39) missense probably damaging 1.00
R4696:Trip11 UTSW 12 101,851,549 (GRCm39) missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101,851,705 (GRCm39) missense probably benign 0.10
R4903:Trip11 UTSW 12 101,853,065 (GRCm39) critical splice donor site probably null
R5001:Trip11 UTSW 12 101,851,169 (GRCm39) nonsense probably null
R5017:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R5227:Trip11 UTSW 12 101,851,179 (GRCm39) missense probably damaging 1.00
R5231:Trip11 UTSW 12 101,851,860 (GRCm39) missense probably damaging 0.96
R5539:Trip11 UTSW 12 101,851,386 (GRCm39) missense probably damaging 0.98
R5754:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5755:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5890:Trip11 UTSW 12 101,852,231 (GRCm39) missense probably damaging 0.99
R5910:Trip11 UTSW 12 101,849,738 (GRCm39) missense probably damaging 1.00
R6083:Trip11 UTSW 12 101,856,001 (GRCm39) missense probably benign 0.00
R6208:Trip11 UTSW 12 101,865,154 (GRCm39) missense probably damaging 1.00
R6216:Trip11 UTSW 12 101,856,859 (GRCm39) missense probably benign 0.31
R6315:Trip11 UTSW 12 101,851,837 (GRCm39) missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101,851,790 (GRCm39) missense probably benign 0.12
R6590:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R7015:Trip11 UTSW 12 101,859,942 (GRCm39) missense probably damaging 1.00
R7023:Trip11 UTSW 12 101,852,126 (GRCm39) missense probably benign 0.13
R7133:Trip11 UTSW 12 101,850,329 (GRCm39) missense probably damaging 0.97
R7271:Trip11 UTSW 12 101,850,611 (GRCm39) missense probably damaging 1.00
R7424:Trip11 UTSW 12 101,851,457 (GRCm39) missense probably damaging 1.00
R7431:Trip11 UTSW 12 101,850,278 (GRCm39) missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101,851,639 (GRCm39) missense probably benign 0.00
R7491:Trip11 UTSW 12 101,851,694 (GRCm39) missense probably damaging 1.00
R7752:Trip11 UTSW 12 101,853,233 (GRCm39) missense probably benign 0.01
R7763:Trip11 UTSW 12 101,811,114 (GRCm39) missense probably benign 0.03
R7779:Trip11 UTSW 12 101,849,796 (GRCm39) missense probably damaging 0.97
R7844:Trip11 UTSW 12 101,844,403 (GRCm39) missense probably damaging 1.00
R8055:Trip11 UTSW 12 101,803,924 (GRCm39) missense probably damaging 1.00
R8076:Trip11 UTSW 12 101,849,741 (GRCm39) missense probably damaging 1.00
R8288:Trip11 UTSW 12 101,860,643 (GRCm39) missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101,811,160 (GRCm39) missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101,879,063 (GRCm39) missense unknown
R8690:Trip11 UTSW 12 101,839,656 (GRCm39) missense possibly damaging 0.76
R8879:Trip11 UTSW 12 101,828,857 (GRCm39) missense probably benign 0.00
R8964:Trip11 UTSW 12 101,811,315 (GRCm39) critical splice donor site probably null
R9005:Trip11 UTSW 12 101,845,131 (GRCm39) missense probably benign 0.02
R9013:Trip11 UTSW 12 101,851,377 (GRCm39) missense probably damaging 0.99
R9020:Trip11 UTSW 12 101,850,770 (GRCm39) missense possibly damaging 0.91
R9041:Trip11 UTSW 12 101,845,127 (GRCm39) missense probably benign 0.06
R9234:Trip11 UTSW 12 101,811,990 (GRCm39) critical splice donor site probably null
R9447:Trip11 UTSW 12 101,850,148 (GRCm39) missense probably damaging 1.00
R9631:Trip11 UTSW 12 101,859,807 (GRCm39) missense probably benign
R9641:Trip11 UTSW 12 101,859,957 (GRCm39) nonsense probably null
R9691:Trip11 UTSW 12 101,850,123 (GRCm39) missense probably benign 0.00
R9751:Trip11 UTSW 12 101,850,765 (GRCm39) missense possibly damaging 0.54
X0020:Trip11 UTSW 12 101,852,172 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGACTCTTTCTAGAAGGCCAC -3'
(R):5'- AAACTAGTACTGTGTTCAGAGGGTTC -3'

Sequencing Primer
(F):5'- GACTCTTTCTAGAAGGCCACTTTGTG -3'
(R):5'- TGTTCAGAGGGTTCTTTCATTAAATC -3'
Posted On 2018-11-06