Incidental Mutation 'R6938:Btg3'
ID540405
Institutional Source Beutler Lab
Gene Symbol Btg3
Ensembl Gene ENSMUSG00000022863
Gene NameB cell translocation gene 3
Synonymstob5, ANA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6938 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78332637-78377192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78360328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 244 (I244V)
Ref Sequence ENSEMBL: ENSMUSP00000023570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023570] [ENSMUST00000114229] [ENSMUST00000148124] [ENSMUST00000231353]
Predicted Effect probably benign
Transcript: ENSMUST00000023570
AA Change: I244V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023570
Gene: ENSMUSG00000022863
AA Change: I244V

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 206 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114229
SMART Domains Protein: ENSMUSP00000109867
Gene: ENSMUSG00000022865

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148124
SMART Domains Protein: ENSMUSP00000119706
Gene: ENSMUSG00000022863

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231353
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes B cell translocation gene 3, a member of the BTG gene family. This family is defined by a conserved N-terminal domain, known to bind transcription factors, and a less conserved C-terminal domain. This protein is thought to have anti-proliferative properties, and may be involved in regulating the G1-S transition to suppress cell cycle progression. Mice deficient for this gene display an increased incidence of lung cancers, and many human lung cancer cells exhibit decreased levels of B cell translocation gene 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A C 2: 130,775,753 H297Q probably benign Het
Acot7 T C 4: 152,217,894 probably null Het
Acp6 T C 3: 97,175,633 M320T probably benign Het
Adam22 A T 5: 8,146,499 Y259N probably benign Het
Akap9 C A 5: 4,046,628 A2501D possibly damaging Het
Angpt2 G T 8: 18,698,089 S385* probably null Het
Asxl2 G C 12: 3,476,149 R255T probably damaging Het
Casr T C 16: 36,495,921 T596A probably damaging Het
Ccl1 A T 11: 82,176,858 V82D probably damaging Het
Col18a1 T A 10: 77,112,499 probably benign Het
Crybg1 T C 10: 43,997,383 D1243G probably benign Het
Drc3 A T 11: 60,394,123 probably null Het
Enpep T C 3: 129,298,950 D528G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gbp4 T C 5: 105,135,077 D109G probably damaging Het
Gstz1 A G 12: 87,147,169 probably null Het
Kctd10 C A 5: 114,370,130 E106* probably null Het
Kctd20 G A 17: 28,961,581 G110S probably benign Het
Klk1b26 A T 7: 44,016,294 T177S probably benign Het
Kyat3 T A 3: 142,725,422 V118E probably damaging Het
Maml3 T C 3: 52,103,738 K136E probably damaging Het
Mex3d T C 10: 80,382,240 N381S possibly damaging Het
Mmrn2 A T 14: 34,398,714 T514S probably benign Het
Nlrp1b G A 11: 71,218,216 A153V probably damaging Het
Olfr70 C T 4: 43,696,286 V296M probably damaging Het
Pcolce T C 5: 137,605,616 T365A probably benign Het
Plbd1 T C 6: 136,616,987 I377V probably benign Het
Plk2 T A 13: 110,396,680 Y192* probably null Het
Rev3l T A 10: 39,862,710 V2820D probably damaging Het
Secisbp2l G T 2: 125,750,352 P650T probably damaging Het
Slc9a5 T C 8: 105,353,432 L69P probably damaging Het
Sp9 T C 2: 73,273,272 C57R probably damaging Het
Tbl3 A T 17: 24,705,213 V190D possibly damaging Het
Timm8b A G 9: 50,604,994 D49G possibly damaging Het
Tmem231 T C 8: 111,933,512 S53G probably damaging Het
Topbp1 T A 9: 103,328,554 V797D probably damaging Het
Trip11 A T 12: 101,837,627 D1665E probably damaging Het
Txk C A 5: 72,699,149 R433L probably damaging Het
Vmn1r19 T C 6: 57,405,007 S182P possibly damaging Het
Vps13b T G 15: 35,423,198 I221M probably damaging Het
Xpo7 T C 14: 70,666,024 N1082D probably benign Het
Other mutations in Btg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0578:Btg3 UTSW 16 78364946 missense probably benign 0.24
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R2860:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R2861:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R2862:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R3698:Btg3 UTSW 16 78364834 missense probably benign
R7336:Btg3 UTSW 16 78364807 missense probably benign 0.15
R8930:Btg3 UTSW 16 78373410 missense probably benign 0.01
R8932:Btg3 UTSW 16 78373410 missense probably benign 0.01
RF007:Btg3 UTSW 16 78332948 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTATCCAACAGAGTCAATGCAC -3'
(R):5'- CACCTCTTCCAATGTGGCAC -3'

Sequencing Primer
(F):5'- TTAAAAACTCAGGCACTTGACTAAC -3'
(R):5'- TCCAATGTGGCACCCTTTG -3'
Posted On2018-11-06