Incidental Mutation 'R6939:Kcnmb2'
ID540412
Institutional Source Beutler Lab
Gene Symbol Kcnmb2
Ensembl Gene ENSMUSG00000037610
Gene Namepotassium large conductance calcium-activated channel, subfamily M, beta member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location31902507-32200180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32198316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000141656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119310] [ENSMUST00000119970] [ENSMUST00000178668] [ENSMUST00000191869] [ENSMUST00000192429] [ENSMUST00000194796]
Predicted Effect probably damaging
Transcript: ENSMUST00000119310
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112531
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 4.5e-22 PFAM
Pfam:CaKB 38 229 3e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119970
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113234
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178668
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136596
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191869
SMART Domains Protein: ENSMUSP00000141955
Gene: ENSMUSG00000037610

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 1.9e-22 PFAM
Pfam:CaKB 33 162 9.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192429
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141656
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194796
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene abolishes inactivation of BK currents in mouse adrenal chromaffin cells and results in slow-wave burst activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Kcnmb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Kcnmb2 APN 3 32198363 unclassified probably benign
IGL02153:Kcnmb2 APN 3 32178844 missense probably damaging 1.00
IGL02211:Kcnmb2 APN 3 32198334 missense probably damaging 1.00
IGL03019:Kcnmb2 APN 3 32198150 missense probably damaging 1.00
IGL03095:Kcnmb2 APN 3 32198127 makesense probably null
R0334:Kcnmb2 UTSW 3 32198359 unclassified probably null
R1781:Kcnmb2 UTSW 3 32179003 critical splice donor site probably null
R2064:Kcnmb2 UTSW 3 32198288 missense probably damaging 0.99
R3858:Kcnmb2 UTSW 3 32198301 missense probably damaging 1.00
R4371:Kcnmb2 UTSW 3 32156102 unclassified probably null
R4766:Kcnmb2 UTSW 3 32181867 missense probably damaging 1.00
R5493:Kcnmb2 UTSW 3 32198142 missense probably damaging 0.97
R6063:Kcnmb2 UTSW 3 32178992 missense probably damaging 1.00
R6240:Kcnmb2 UTSW 3 32181896 missense probably damaging 1.00
R6928:Kcnmb2 UTSW 3 32199041 missense probably benign 0.05
R7683:Kcnmb2 UTSW 3 32198316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTCTCTCGTGAGTGTCG -3'
(R):5'- TGCATATAGGACAGCGTTTGC -3'

Sequencing Primer
(F):5'- CTCGTGAGTGTCGTCATGGAAAAC -3'
(R):5'- ATAGGACAGCGTTTGCATTATTG -3'
Posted On2018-11-06