Incidental Mutation 'R6939:Clrn2'
ID540418
Institutional Source Beutler Lab
Gene Symbol Clrn2
Ensembl Gene ENSMUSG00000049530
Gene Nameclarin 2
SynonymsEG624224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45453751-45464149 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45453754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000053250] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
Predicted Effect probably benign
Transcript: ENSMUST00000015950
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053250
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118097
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127562
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154962
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197946
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the clarin family of genes. The clarins appear to belong to a large superfamily of small integral membrane glycoproteins with four transmembrane domains. The exact function of this gene is unknown. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Clrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Clrn2 APN 5 45463969 utr 3 prime probably benign
IGL01538:Clrn2 APN 5 45460066 missense probably damaging 1.00
IGL01585:Clrn2 APN 5 45460158 missense probably benign 0.00
IGL01783:Clrn2 APN 5 45460161 missense probably benign
IGL02479:Clrn2 APN 5 45463912 missense probably benign 0.03
IGL02709:Clrn2 APN 5 45460153 missense probably damaging 1.00
IGL03220:Clrn2 APN 5 45463728 missense probably damaging 1.00
R1443:Clrn2 UTSW 5 45460111 missense probably damaging 1.00
R1942:Clrn2 UTSW 5 45453995 missense probably benign 0.26
R2258:Clrn2 UTSW 5 45453962 missense probably benign 0.03
R4806:Clrn2 UTSW 5 45454004 missense probably damaging 1.00
R5943:Clrn2 UTSW 5 45463719 missense probably benign 0.01
R5987:Clrn2 UTSW 5 45454027 missense probably benign 0.09
R6029:Clrn2 UTSW 5 45460186 missense probably damaging 1.00
R6371:Clrn2 UTSW 5 45460198 missense possibly damaging 0.62
R6474:Clrn2 UTSW 5 45463732 missense probably benign 0.04
R6881:Clrn2 UTSW 5 45453822 nonsense probably null
R7156:Clrn2 UTSW 5 45453916 missense probably damaging 0.99
R7186:Clrn2 UTSW 5 45453773 unclassified probably benign
R7392:Clrn2 UTSW 5 45463909 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CCTCTGCTGAAACCCTAGTCTG -3'
(R):5'- GTGGCATTGACCAAATCCACTC -3'

Sequencing Primer
(F):5'- AACCCTAGTCTGTTGGGAGATATAG -3'
(R):5'- GTCTGACACAAGATTTTCCCACTCAG -3'
Posted On2018-11-06