Incidental Mutation 'R6939:Trpm1'
ID540434
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64268297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 462 (T462A)
Ref Sequence ENSEMBL: ENSMUSP00000145593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: T1346A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: T1346A

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: T1230A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: T1352A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
AA Change: T462A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTCTGATCTGATCCAGGCTC -3'
(R):5'- AGCTTCCGTGCTCTTGAAATC -3'

Sequencing Primer
(F):5'- GATCTGATCCAGGCTCGATCTCG -3'
(R):5'- GTGCTCTTGAAATCCGCCCG -3'
Posted On2018-11-06