Mutagenetix > Incidental Mutation

Incidental Mutation 'R6939:Trpm1'

540434

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6939 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64268297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 462 (T462A)

Ref Sequence

ENSEMBL: ENSMUSP00000145593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: T1346A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: T1346A

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: T1230A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: T1352A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314
AA Change: T462A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,058	K231N	possibly damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
A1bg	G	A	15: 60,920,395	P128L	probably damaging	Het
Acsm3	T	C	7: 119,778,455	V401A	probably damaging	Het
Arhgef11	C	A	3: 87,686,920	N93K	probably damaging	Het
C1ra	G	A	6: 124,512,801		probably null	Het
Camk2a	A	G	18: 60,958,154	E236G	probably damaging	Het
Casc1	A	G	6: 145,175,219	F625L	possibly damaging	Het
Cav2	C	A	6: 17,281,411	D17E	possibly damaging	Het
Ccdc149	T	C	5: 52,376,265	S520G	probably benign	Het
Chd4	C	A	6: 125,106,538	H674Q	probably damaging	Het
Clrn2	A	T	5: 45,453,754		probably benign	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cyp2c67	T	C	19: 39,643,334	T140A	possibly damaging	Het
D7Ertd443e	T	C	7: 134,364,479		probably null	Het
Dcdc2c	G	T	12: 28,541,497	Q131K	probably benign	Het
Dmpk	T	A	7: 19,088,224	V369E	probably damaging	Het
Dnah11	A	T	12: 118,106,562	W1503R	probably damaging	Het
Dok2	T	C	14: 70,775,605	V71A	probably benign	Het
Dqx1	A	T	6: 83,059,465	Q150L	probably damaging	Het
Extl3	A	G	14: 65,066,740	I740T	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat2	C	T	11: 55,252,474	W4183*	probably null	Het
Fkrp	C	T	7: 16,811,826	R37Q	probably benign	Het
Frem3	A	G	8: 80,615,145	K1356E	probably benign	Het
Fus	A	T	7: 127,972,569		probably benign	Het
Gabarapl2	C	A	8: 111,942,569	S53*	probably null	Het
Gjc1	A	C	11: 102,800,907	M90R	probably damaging	Het
Gm30083	C	T	14: 34,003,600		probably null	Het
Gm7356	T	A	17: 14,001,125	Y214F	probably benign	Het
Hexdc	A	T	11: 121,222,338	D533V	probably benign	Het
Ift172	G	A	5: 31,257,586	A1364V	probably damaging	Het
Ighmbp2	A	T	19: 3,276,907	F186Y	probably damaging	Het
Inpp5e	C	A	2: 26,407,762		probably null	Het
Iqcb1	A	G	16: 36,839,912	T146A	possibly damaging	Het
Kcnmb2	A	G	3: 32,198,316	Y222C	probably damaging	Het
Kdm6b	A	G	11: 69,406,762	W284R	probably damaging	Het
Ksr2	T	A	5: 117,765,561	*952R	probably null	Het
Ldlrap1	C	A	4: 134,767,974		probably benign	Het
Mpdu1	G	A	11: 69,658,055		probably benign	Het
Mrgprh	A	T	17: 12,876,935	T21S	probably benign	Het
Muc16	T	A	9: 18,638,537	T5487S	probably benign	Het
Mydgf	A	G	17: 56,183,737		probably null	Het
Napa	T	C	7: 16,115,257	C241R	possibly damaging	Het
Olfr181	A	T	16: 58,926,285	Y95*	probably null	Het
Olfr479	C	A	7: 108,055,105	A41E	possibly damaging	Het
Olfr964-ps1	T	C	9: 39,686,891	T18A	possibly damaging	Het
Pla2g4f	A	T	2: 120,307,301	L326Q	probably damaging	Het
Pramef25	T	C	4: 143,948,796	T487A	probably benign	Het
Psme4	T	A	11: 30,837,291	Y1029N	probably damaging	Het
Ptprj	T	C	2: 90,459,514	T707A	possibly damaging	Het
Raet1e	T	A	10: 22,174,357	M13K	possibly damaging	Het
Rftn2	T	C	1: 55,194,349		probably null	Het
Rmi1	A	G	13: 58,409,355	I473V	probably benign	Het
Rps6ka4	A	G	19: 6,838,069	F186L	probably damaging	Het
Ryr1	T	A	7: 29,052,326	M3672L	possibly damaging	Het
Smarca5	A	T	8: 80,705,320	C890S	possibly damaging	Het
Tdrd12	C	T	7: 35,485,599		probably null	Het
Tecta	T	C	9: 42,347,997	N1530S	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmem94	A	G	11: 115,785,830	S54G	possibly damaging	Het
Tnk2	T	C	16: 32,663,878	V41A	probably damaging	Het
Tsg101	T	C	7: 46,907,099	T61A	probably benign	Het
Usp42	T	C	5: 143,727,969	N17D	probably damaging	Het
Zfp607a	T	A	7: 27,879,048	C514*	probably null	Het
Zfp866	G	T	8: 69,766,221	Q250K	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTCTGATCTGATCCAGGCTC -3'
(R):5'- AGCTTCCGTGCTCTTGAAATC -3'

Sequencing Primer
(F):5'- GATCTGATCCAGGCTCGATCTCG -3'
(R):5'- GTGCTCTTGAAATCCGCCCG -3'

Posted On

2018-11-06