Mutagenetix > Incidental Mutation

Incidental Mutation 'R6939:Smarca5'

540442

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

045053-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6939 (G1)

Quality Score

189.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80705320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 890 (C890S)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043359
AA Change: C890S

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: C890S

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,058	K231N	possibly damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
A1bg	G	A	15: 60,920,395	P128L	probably damaging	Het
Acsm3	T	C	7: 119,778,455	V401A	probably damaging	Het
Arhgef11	C	A	3: 87,686,920	N93K	probably damaging	Het
C1ra	G	A	6: 124,512,801		probably null	Het
Camk2a	A	G	18: 60,958,154	E236G	probably damaging	Het
Casc1	A	G	6: 145,175,219	F625L	possibly damaging	Het
Cav2	C	A	6: 17,281,411	D17E	possibly damaging	Het
Ccdc149	T	C	5: 52,376,265	S520G	probably benign	Het
Chd4	C	A	6: 125,106,538	H674Q	probably damaging	Het
Clrn2	A	T	5: 45,453,754		probably benign	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cyp2c67	T	C	19: 39,643,334	T140A	possibly damaging	Het
D7Ertd443e	T	C	7: 134,364,479		probably null	Het
Dcdc2c	G	T	12: 28,541,497	Q131K	probably benign	Het
Dmpk	T	A	7: 19,088,224	V369E	probably damaging	Het
Dnah11	A	T	12: 118,106,562	W1503R	probably damaging	Het
Dok2	T	C	14: 70,775,605	V71A	probably benign	Het
Dqx1	A	T	6: 83,059,465	Q150L	probably damaging	Het
Extl3	A	G	14: 65,066,740	I740T	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat2	C	T	11: 55,252,474	W4183*	probably null	Het
Fkrp	C	T	7: 16,811,826	R37Q	probably benign	Het
Frem3	A	G	8: 80,615,145	K1356E	probably benign	Het
Fus	A	T	7: 127,972,569		probably benign	Het
Gabarapl2	C	A	8: 111,942,569	S53*	probably null	Het
Gjc1	A	C	11: 102,800,907	M90R	probably damaging	Het
Gm30083	C	T	14: 34,003,600		probably null	Het
Gm7356	T	A	17: 14,001,125	Y214F	probably benign	Het
Hexdc	A	T	11: 121,222,338	D533V	probably benign	Het
Ift172	G	A	5: 31,257,586	A1364V	probably damaging	Het
Ighmbp2	A	T	19: 3,276,907	F186Y	probably damaging	Het
Inpp5e	C	A	2: 26,407,762		probably null	Het
Iqcb1	A	G	16: 36,839,912	T146A	possibly damaging	Het
Kcnmb2	A	G	3: 32,198,316	Y222C	probably damaging	Het
Kdm6b	A	G	11: 69,406,762	W284R	probably damaging	Het
Ksr2	T	A	5: 117,765,561	*952R	probably null	Het
Ldlrap1	C	A	4: 134,767,974		probably benign	Het
Mpdu1	G	A	11: 69,658,055		probably benign	Het
Mrgprh	A	T	17: 12,876,935	T21S	probably benign	Het
Muc16	T	A	9: 18,638,537	T5487S	probably benign	Het
Mydgf	A	G	17: 56,183,737		probably null	Het
Napa	T	C	7: 16,115,257	C241R	possibly damaging	Het
Olfr181	A	T	16: 58,926,285	Y95*	probably null	Het
Olfr479	C	A	7: 108,055,105	A41E	possibly damaging	Het
Olfr964-ps1	T	C	9: 39,686,891	T18A	possibly damaging	Het
Pla2g4f	A	T	2: 120,307,301	L326Q	probably damaging	Het
Pramef25	T	C	4: 143,948,796	T487A	probably benign	Het
Psme4	T	A	11: 30,837,291	Y1029N	probably damaging	Het
Ptprj	T	C	2: 90,459,514	T707A	possibly damaging	Het
Raet1e	T	A	10: 22,174,357	M13K	possibly damaging	Het
Rftn2	T	C	1: 55,194,349		probably null	Het
Rmi1	A	G	13: 58,409,355	I473V	probably benign	Het
Rps6ka4	A	G	19: 6,838,069	F186L	probably damaging	Het
Ryr1	T	A	7: 29,052,326	M3672L	possibly damaging	Het
Tdrd12	C	T	7: 35,485,599		probably null	Het
Tecta	T	C	9: 42,347,997	N1530S	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmem94	A	G	11: 115,785,830	S54G	possibly damaging	Het
Tnk2	T	C	16: 32,663,878	V41A	probably damaging	Het
Trpm1	A	G	7: 64,268,297	T462A	probably benign	Het
Tsg101	T	C	7: 46,907,099	T61A	probably benign	Het
Usp42	T	C	5: 143,727,969	N17D	probably damaging	Het
Zfp607a	T	A	7: 27,879,048	C514*	probably null	Het
Zfp866	G	T	8: 69,766,221	Q250K	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGTCTTCTTTAAACCAGGC -3'
(R):5'- TTTATCAAGGCTAATGAGAAGTGGG -3'

Sequencing Primer
(F):5'- ACCAGGCTAACAATTTAATATTCAGG -3'
(R):5'- CTAATGAGAAGTGGGGTCGTG -3'

Posted On

2018-11-06