Incidental Mutation 'R6939:Gabarapl2'
ID540443
Institutional Source Beutler Lab
Gene Symbol Gabarapl2
Ensembl Gene ENSMUSG00000031950
Gene Namegamma-aminobutyric acid (GABA) A receptor-associated protein-like 2
Synonyms2900019O08Rik, Gef2, 0610012F20Rik, GATE-16
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6939 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111940703-111953612 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 111942569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 53 (S53*)
Ref Sequence ENSEMBL: ENSMUSP00000034428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034428]
Predicted Effect probably null
Transcript: ENSMUST00000034428
AA Change: S53*
SMART Domains Protein: ENSMUSP00000034428
Gene: ENSMUSG00000031950
AA Change: S53*

DomainStartEndE-ValueType
Pfam:Atg8 13 116 6.1e-53 PFAM
Pfam:APG12 28 116 7.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mpdu1 G A 11: 69,658,055 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Gabarapl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Gabarapl2 APN 8 111941199 missense probably damaging 1.00
IGL03161:Gabarapl2 APN 8 111942536 missense probably benign 0.11
IGL03162:Gabarapl2 APN 8 111942536 missense probably benign 0.11
R0743:Gabarapl2 UTSW 8 111942505 missense probably damaging 0.99
R0884:Gabarapl2 UTSW 8 111942505 missense probably damaging 0.99
R3916:Gabarapl2 UTSW 8 111952396 missense probably benign 0.05
R3917:Gabarapl2 UTSW 8 111952396 missense probably benign 0.05
R4646:Gabarapl2 UTSW 8 111942553 missense probably damaging 0.97
R4685:Gabarapl2 UTSW 8 111942518 missense probably benign 0.01
R5289:Gabarapl2 UTSW 8 111942595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAGCCCTGTGGGTAAGTG -3'
(R):5'- CTAAGAACACCTCCTATGGTTTGAG -3'

Sequencing Primer
(F):5'- TAAGTGCTGGAGCTCGCTCTC -3'
(R):5'- AGTTTTATAAGCGGCGAATGGATTTC -3'
Posted On2018-11-06