Mutagenetix > Incidental Mutation

Incidental Mutation 'R6939:Psme4'

540448

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

045053-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6939 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30837291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1029 (Y1029N)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: Y1029N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: Y1029N

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

99% (66/67)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,058	K231N	possibly damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
A1bg	G	A	15: 60,920,395	P128L	probably damaging	Het
Acsm3	T	C	7: 119,778,455	V401A	probably damaging	Het
Arhgef11	C	A	3: 87,686,920	N93K	probably damaging	Het
C1ra	G	A	6: 124,512,801		probably null	Het
Camk2a	A	G	18: 60,958,154	E236G	probably damaging	Het
Casc1	A	G	6: 145,175,219	F625L	possibly damaging	Het
Cav2	C	A	6: 17,281,411	D17E	possibly damaging	Het
Ccdc149	T	C	5: 52,376,265	S520G	probably benign	Het
Chd4	C	A	6: 125,106,538	H674Q	probably damaging	Het
Clrn2	A	T	5: 45,453,754		probably benign	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cyp2c67	T	C	19: 39,643,334	T140A	possibly damaging	Het
D7Ertd443e	T	C	7: 134,364,479		probably null	Het
Dcdc2c	G	T	12: 28,541,497	Q131K	probably benign	Het
Dmpk	T	A	7: 19,088,224	V369E	probably damaging	Het
Dnah11	A	T	12: 118,106,562	W1503R	probably damaging	Het
Dok2	T	C	14: 70,775,605	V71A	probably benign	Het
Dqx1	A	T	6: 83,059,465	Q150L	probably damaging	Het
Extl3	A	G	14: 65,066,740	I740T	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat2	C	T	11: 55,252,474	W4183*	probably null	Het
Fkrp	C	T	7: 16,811,826	R37Q	probably benign	Het
Frem3	A	G	8: 80,615,145	K1356E	probably benign	Het
Fus	A	T	7: 127,972,569		probably benign	Het
Gabarapl2	C	A	8: 111,942,569	S53*	probably null	Het
Gjc1	A	C	11: 102,800,907	M90R	probably damaging	Het
Gm30083	C	T	14: 34,003,600		probably null	Het
Gm7356	T	A	17: 14,001,125	Y214F	probably benign	Het
Hexdc	A	T	11: 121,222,338	D533V	probably benign	Het
Ift172	G	A	5: 31,257,586	A1364V	probably damaging	Het
Ighmbp2	A	T	19: 3,276,907	F186Y	probably damaging	Het
Inpp5e	C	A	2: 26,407,762		probably null	Het
Iqcb1	A	G	16: 36,839,912	T146A	possibly damaging	Het
Kcnmb2	A	G	3: 32,198,316	Y222C	probably damaging	Het
Kdm6b	A	G	11: 69,406,762	W284R	probably damaging	Het
Ksr2	T	A	5: 117,765,561	*952R	probably null	Het
Ldlrap1	C	A	4: 134,767,974		probably benign	Het
Mpdu1	G	A	11: 69,658,055		probably benign	Het
Mrgprh	A	T	17: 12,876,935	T21S	probably benign	Het
Muc16	T	A	9: 18,638,537	T5487S	probably benign	Het
Mydgf	A	G	17: 56,183,737		probably null	Het
Napa	T	C	7: 16,115,257	C241R	possibly damaging	Het
Olfr181	A	T	16: 58,926,285	Y95*	probably null	Het
Olfr479	C	A	7: 108,055,105	A41E	possibly damaging	Het
Olfr964-ps1	T	C	9: 39,686,891	T18A	possibly damaging	Het
Pla2g4f	A	T	2: 120,307,301	L326Q	probably damaging	Het
Pramef25	T	C	4: 143,948,796	T487A	probably benign	Het
Ptprj	T	C	2: 90,459,514	T707A	possibly damaging	Het
Raet1e	T	A	10: 22,174,357	M13K	possibly damaging	Het
Rftn2	T	C	1: 55,194,349		probably null	Het
Rmi1	A	G	13: 58,409,355	I473V	probably benign	Het
Rps6ka4	A	G	19: 6,838,069	F186L	probably damaging	Het
Ryr1	T	A	7: 29,052,326	M3672L	possibly damaging	Het
Smarca5	A	T	8: 80,705,320	C890S	possibly damaging	Het
Tdrd12	C	T	7: 35,485,599		probably null	Het
Tecta	T	C	9: 42,347,997	N1530S	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmem94	A	G	11: 115,785,830	S54G	possibly damaging	Het
Tnk2	T	C	16: 32,663,878	V41A	probably damaging	Het
Trpm1	A	G	7: 64,268,297	T462A	probably benign	Het
Tsg101	T	C	7: 46,907,099	T61A	probably benign	Het
Usp42	T	C	5: 143,727,969	N17D	probably damaging	Het
Zfp607a	T	A	7: 27,879,048	C514*	probably null	Het
Zfp866	G	T	8: 69,766,221	Q250K	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTTTACAAAACTGCCTACC -3'
(R):5'- GTCTATGAATCTTTTCAGCAAGGTC -3'

Sequencing Primer
(F):5'- ATTAATGGGTCCACTTGCTTATACC -3'
(R):5'- TCAGCAAGGTCATCAAATAGTCTC -3'

Posted On

2018-11-06