Mutagenetix > Incidental Mutations

Incidental Mutation 'R6939:Cyp2c67'

540472

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R6939 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39643334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 140 (T140A)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

AlphaFold

Q569X9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067328
AA Change: T140A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: T140A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,058	K231N	possibly damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
A1bg	G	A	15: 60,920,395	P128L	probably damaging	Het
Acsm3	T	C	7: 119,778,455	V401A	probably damaging	Het
Arhgef11	C	A	3: 87,686,920	N93K	probably damaging	Het
C1ra	G	A	6: 124,512,801		probably null	Het
Camk2a	A	G	18: 60,958,154	E236G	probably damaging	Het
Casc1	A	G	6: 145,175,219	F625L	possibly damaging	Het
Cav2	C	A	6: 17,281,411	D17E	possibly damaging	Het
Ccdc149	T	C	5: 52,376,265	S520G	probably benign	Het
Chd4	C	A	6: 125,106,538	H674Q	probably damaging	Het
Clrn2	A	T	5: 45,453,754		probably benign	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
D7Ertd443e	T	C	7: 134,364,479		probably null	Het
Dcdc2c	G	T	12: 28,541,497	Q131K	probably benign	Het
Dmpk	T	A	7: 19,088,224	V369E	probably damaging	Het
Dnah11	A	T	12: 118,106,562	W1503R	probably damaging	Het
Dok2	T	C	14: 70,775,605	V71A	probably benign	Het
Dqx1	A	T	6: 83,059,465	Q150L	probably damaging	Het
Extl3	A	G	14: 65,066,740	I740T	possibly damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat2	C	T	11: 55,252,474	W4183*	probably null	Het
Fkrp	C	T	7: 16,811,826	R37Q	probably benign	Het
Frem3	A	G	8: 80,615,145	K1356E	probably benign	Het
Fus	A	T	7: 127,972,569		probably benign	Het
Gabarapl2	C	A	8: 111,942,569	S53*	probably null	Het
Gjc1	A	C	11: 102,800,907	M90R	probably damaging	Het
Gm30083	C	T	14: 34,003,600		probably null	Het
Gm7356	T	A	17: 14,001,125	Y214F	probably benign	Het
Hexdc	A	T	11: 121,222,338	D533V	probably benign	Het
Ift172	G	A	5: 31,257,586	A1364V	probably damaging	Het
Ighmbp2	A	T	19: 3,276,907	F186Y	probably damaging	Het
Inpp5e	C	A	2: 26,407,762		probably null	Het
Iqcb1	A	G	16: 36,839,912	T146A	possibly damaging	Het
Kcnmb2	A	G	3: 32,198,316	Y222C	probably damaging	Het
Kdm6b	A	G	11: 69,406,762	W284R	probably damaging	Het
Ksr2	T	A	5: 117,765,561	*952R	probably null	Het
Ldlrap1	C	A	4: 134,767,974		probably benign	Het
Mpdu1	G	A	11: 69,658,055		probably benign	Het
Mrgprh	A	T	17: 12,876,935	T21S	probably benign	Het
Muc16	T	A	9: 18,638,537	T5487S	probably benign	Het
Mydgf	A	G	17: 56,183,737		probably null	Het
Napa	T	C	7: 16,115,257	C241R	possibly damaging	Het
Olfr181	A	T	16: 58,926,285	Y95*	probably null	Het
Olfr479	C	A	7: 108,055,105	A41E	possibly damaging	Het
Olfr964-ps1	T	C	9: 39,686,891	T18A	possibly damaging	Het
Pla2g4f	A	T	2: 120,307,301	L326Q	probably damaging	Het
Pramef25	T	C	4: 143,948,796	T487A	probably benign	Het
Psme4	T	A	11: 30,837,291	Y1029N	probably damaging	Het
Ptprj	T	C	2: 90,459,514	T707A	possibly damaging	Het
Raet1e	T	A	10: 22,174,357	M13K	possibly damaging	Het
Rftn2	T	C	1: 55,194,349		probably null	Het
Rmi1	A	G	13: 58,409,355	I473V	probably benign	Het
Rps6ka4	A	G	19: 6,838,069	F186L	probably damaging	Het
Ryr1	T	A	7: 29,052,326	M3672L	possibly damaging	Het
Smarca5	A	T	8: 80,705,320	C890S	possibly damaging	Het
Tdrd12	C	T	7: 35,485,599		probably null	Het
Tecta	T	C	9: 42,347,997	N1530S	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmem94	A	G	11: 115,785,830	S54G	possibly damaging	Het
Tnk2	T	C	16: 32,663,878	V41A	probably damaging	Het
Trpm1	A	G	7: 64,268,297	T462A	probably benign	Het
Tsg101	T	C	7: 46,907,099	T61A	probably benign	Het
Usp42	T	C	5: 143,727,969	N17D	probably damaging	Het
Zfp607a	T	A	7: 27,879,048	C514*	probably null	Het
Zfp866	G	T	8: 69,766,221	Q250K	probably damaging	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0975:Cyp2c67	UTSW	19	39609178	missense	possibly damaging	0.49
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1505:Cyp2c67	UTSW	19	39648964	missense	probably benign	0.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R2181:Cyp2c67	UTSW	19	39609097	missense	possibly damaging	0.94
R3817:Cyp2c67	UTSW	19	39638683	missense	probably benign	0.00
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5345:Cyp2c67	UTSW	19	39626232	missense	probably benign	0.01
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
R8717:Cyp2c67	UTSW	19	39638711	missense	probably benign	0.05
R8728:Cyp2c67	UTSW	19	39626161	missense	probably damaging	1.00
R9275:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9278:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9376:Cyp2c67	UTSW	19	39638734	missense	probably damaging	1.00
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATGGTACCTATACTCATGACATCTC -3'
(R):5'- GCAGTTTCCAGAGCAAGCTG -3'

Sequencing Primer
(F):5'- GAGAATCTGACCTGCACT -3'
(R):5'- AGAGTAGAGGTCATGCTTGC -3'

Posted On

2018-11-06