Incidental Mutation 'R6940:Tas2r134'
ID540480
Institutional Source Beutler Lab
Gene Symbol Tas2r134
Ensembl Gene ENSMUSG00000056115
Gene Nametaste receptor, type 2, member 134
SynonymsT2R134, Tas2r34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6940 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location51627511-51628408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51628136 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 209 (H209R)
Ref Sequence ENSEMBL: ENSMUSP00000064657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070028]
Predicted Effect probably benign
Transcript: ENSMUST00000070028
AA Change: H209R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064657
Gene: ENSMUSG00000056115
AA Change: H209R

DomainStartEndE-ValueType
Pfam:TAS2R 1 291 1.4e-75 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 C A 9: 54,609,097 A667S probably benign Het
Ank2 G A 3: 126,941,972 probably benign Het
Arhgef28 A G 13: 97,965,530 L812P possibly damaging Het
Armc5 C T 7: 128,240,298 R263* probably null Het
Cadps2 A T 6: 23,302,492 V740E probably damaging Het
Cckbr T C 7: 105,434,896 V279A probably benign Het
Cd101 T C 3: 101,003,702 D880G probably damaging Het
Cep350 A T 1: 155,928,551 S929T probably benign Het
Chaf1b G A 16: 93,905,965 R556H probably benign Het
Csn1s1 A T 5: 87,675,023 Q69L possibly damaging Het
Dennd1b T C 1: 139,053,417 probably null Het
Dnah11 T C 12: 118,198,768 D22G probably benign Het
Dnah7a T C 1: 53,631,677 H472R probably benign Het
Dnah7b G A 1: 46,119,268 R337H probably benign Het
Eif2ak3 T C 6: 70,892,402 V691A possibly damaging Het
Ern2 T C 7: 122,186,146 R3G probably benign Het
Fat3 T C 9: 15,916,800 probably null Het
Fnbp4 T C 2: 90,745,514 F20L unknown Het
Gm9573 C A 17: 35,623,226 probably benign Het
Gtf2b C A 3: 142,778,255 D63E probably damaging Het
Hydin A G 8: 110,490,611 Y1377C probably damaging Het
Klf1 A G 8: 84,902,095 T41A possibly damaging Het
Lce3d G A 3: 92,958,234 S52N unknown Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrfip1 T A 1: 91,122,413 probably null Het
Ltbp4 A C 7: 27,308,944 V1313G probably damaging Het
Morc1 C A 16: 48,479,845 S235* probably null Het
Mr1 T G 1: 155,129,268 *342S probably null Het
Nol4l T A 2: 153,411,764 S630C probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Olfr644 A G 7: 104,068,413 I206T possibly damaging Het
Otof A G 5: 30,371,643 V1807A probably damaging Het
Pde5a T A 3: 122,779,032 V354E possibly damaging Het
Pmfbp1 A T 8: 109,525,191 E355D probably damaging Het
Ppp2r2c A G 5: 36,927,531 D112G probably damaging Het
Prkacb A T 3: 146,751,499 I37N probably damaging Het
Prox2 T C 12: 85,094,574 D285G probably benign Het
Ranbp3l A G 15: 9,011,919 S61G probably benign Het
Rnf214 T A 9: 45,890,898 T289S probably damaging Het
Rnf217 G T 10: 31,505,977 probably null Het
Sc5d A T 9: 42,255,427 M272K probably benign Het
Slco6c1 T C 1: 97,072,901 T542A possibly damaging Het
Sord T A 2: 122,264,055 I308N probably damaging Het
Syvn1 A T 19: 6,051,184 probably benign Het
Trak1 T C 9: 121,443,718 V214A possibly damaging Het
Trpm5 C A 7: 143,084,810 E322* probably null Het
Ttf2 T C 3: 100,969,515 T17A probably damaging Het
Vmn2r53 T C 7: 12,582,416 E492G probably benign Het
Xndc1 T C 7: 102,077,887 V161A probably benign Het
Other mutations in Tas2r134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL00563:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL01121:Tas2r134 APN 2 51627989 missense probably damaging 1.00
IGL01122:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01128:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01132:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01312:Tas2r134 APN 2 51628235 missense probably damaging 1.00
IGL01419:Tas2r134 APN 2 51627747 nonsense probably null
IGL01774:Tas2r134 APN 2 51628148 missense probably benign 0.07
IGL02735:Tas2r134 APN 2 51627827 missense probably damaging 1.00
R0799:Tas2r134 UTSW 2 51628373 missense probably benign 0.00
R1205:Tas2r134 UTSW 2 51627986 missense probably benign 0.00
R2267:Tas2r134 UTSW 2 51628237 missense probably benign 0.01
R3736:Tas2r134 UTSW 2 51627774 missense probably damaging 1.00
R5254:Tas2r134 UTSW 2 51627547 missense probably benign 0.39
R5752:Tas2r134 UTSW 2 51627868 missense probably damaging 1.00
R6162:Tas2r134 UTSW 2 51627559 missense probably damaging 1.00
R6954:Tas2r134 UTSW 2 51627770 missense probably benign 0.00
R6996:Tas2r134 UTSW 2 51627589 missense probably benign 0.00
R7206:Tas2r134 UTSW 2 51628108 missense probably benign 0.02
R7303:Tas2r134 UTSW 2 51628133 missense probably benign 0.01
R7348:Tas2r134 UTSW 2 51628402 missense possibly damaging 0.92
R7479:Tas2r134 UTSW 2 51627529 missense not run
R7575:Tas2r134 UTSW 2 51628154 missense probably damaging 1.00
R7686:Tas2r134 UTSW 2 51628243 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACTGTCAGCCATCTCCTCAG -3'
(R):5'- CAGTGAGATGCCCATGTAGG -3'

Sequencing Primer
(F):5'- ACAATTGCCCTTCAGATGGCG -3'
(R):5'- TGAGATGCCCATGTAGGTTACCAC -3'
Posted On2018-11-06