Incidental Mutation 'R6940:Nr4a3'
ID540491
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6940 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48051486 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 80 (P80L)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably benign
Transcript: ENSMUST00000030025
AA Change: P80L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: P80L

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: P109L

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 C A 9: 54,609,097 A667S probably benign Het
Ank2 G A 3: 126,941,972 probably benign Het
Arhgef28 A G 13: 97,965,530 L812P possibly damaging Het
Armc5 C T 7: 128,240,298 R263* probably null Het
Cadps2 A T 6: 23,302,492 V740E probably damaging Het
Cckbr T C 7: 105,434,896 V279A probably benign Het
Cd101 T C 3: 101,003,702 D880G probably damaging Het
Cep350 A T 1: 155,928,551 S929T probably benign Het
Chaf1b G A 16: 93,905,965 R556H probably benign Het
Csn1s1 A T 5: 87,675,023 Q69L possibly damaging Het
Dennd1b T C 1: 139,053,417 probably null Het
Dnah11 T C 12: 118,198,768 D22G probably benign Het
Dnah7a T C 1: 53,631,677 H472R probably benign Het
Dnah7b G A 1: 46,119,268 R337H probably benign Het
Eif2ak3 T C 6: 70,892,402 V691A possibly damaging Het
Ern2 T C 7: 122,186,146 R3G probably benign Het
Fat3 T C 9: 15,916,800 probably null Het
Fnbp4 T C 2: 90,745,514 F20L unknown Het
Gm9573 C A 17: 35,623,226 probably benign Het
Gtf2b C A 3: 142,778,255 D63E probably damaging Het
Hydin A G 8: 110,490,611 Y1377C probably damaging Het
Klf1 A G 8: 84,902,095 T41A possibly damaging Het
Lce3d G A 3: 92,958,234 S52N unknown Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrfip1 T A 1: 91,122,413 probably null Het
Ltbp4 A C 7: 27,308,944 V1313G probably damaging Het
Morc1 C A 16: 48,479,845 S235* probably null Het
Mr1 T G 1: 155,129,268 *342S probably null Het
Nol4l T A 2: 153,411,764 S630C probably benign Het
Olfr644 A G 7: 104,068,413 I206T possibly damaging Het
Otof A G 5: 30,371,643 V1807A probably damaging Het
Pde5a T A 3: 122,779,032 V354E possibly damaging Het
Pmfbp1 A T 8: 109,525,191 E355D probably damaging Het
Ppp2r2c A G 5: 36,927,531 D112G probably damaging Het
Prkacb A T 3: 146,751,499 I37N probably damaging Het
Prox2 T C 12: 85,094,574 D285G probably benign Het
Ranbp3l A G 15: 9,011,919 S61G probably benign Het
Rnf214 T A 9: 45,890,898 T289S probably damaging Het
Rnf217 G T 10: 31,505,977 probably null Het
Sc5d A T 9: 42,255,427 M272K probably benign Het
Slco6c1 T C 1: 97,072,901 T542A possibly damaging Het
Sord T A 2: 122,264,055 I308N probably damaging Het
Syvn1 A T 19: 6,051,184 probably benign Het
Tas2r134 A G 2: 51,628,136 H209R probably benign Het
Trak1 T C 9: 121,443,718 V214A possibly damaging Het
Trpm5 C A 7: 143,084,810 E322* probably null Het
Ttf2 T C 3: 100,969,515 T17A probably damaging Het
Vmn2r53 T C 7: 12,582,416 E492G probably benign Het
Xndc1 T C 7: 102,077,887 V161A probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAAGCCCAGTATAGCCCTTC -3'
(R):5'- CTGCTTGAAGTACATGGAGGTG -3'

Sequencing Primer
(F):5'- CGCAGACTTATGGCTCGGAATAC -3'
(R):5'- TGCTGGGCAGTACCTCGTC -3'
Posted On2018-11-06