Incidental Mutation 'R6940:Ern2'
ID540501
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 2
SynonymsIre1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6940 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location122169893-122186207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122186146 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 3 (R3G)
Ref Sequence ENSEMBL: ENSMUSP00000145716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]
Predicted Effect probably benign
Transcript: ENSMUST00000033153
AA Change: R3G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: R3G

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206198
AA Change: R3G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 C A 9: 54,609,097 A667S probably benign Het
Ank2 G A 3: 126,941,972 probably benign Het
Arhgef28 A G 13: 97,965,530 L812P possibly damaging Het
Armc5 C T 7: 128,240,298 R263* probably null Het
Cadps2 A T 6: 23,302,492 V740E probably damaging Het
Cckbr T C 7: 105,434,896 V279A probably benign Het
Cd101 T C 3: 101,003,702 D880G probably damaging Het
Cep350 A T 1: 155,928,551 S929T probably benign Het
Chaf1b G A 16: 93,905,965 R556H probably benign Het
Csn1s1 A T 5: 87,675,023 Q69L possibly damaging Het
Dennd1b T C 1: 139,053,417 probably null Het
Dnah11 T C 12: 118,198,768 D22G probably benign Het
Dnah7a T C 1: 53,631,677 H472R probably benign Het
Dnah7b G A 1: 46,119,268 R337H probably benign Het
Eif2ak3 T C 6: 70,892,402 V691A possibly damaging Het
Fat3 T C 9: 15,916,800 probably null Het
Fnbp4 T C 2: 90,745,514 F20L unknown Het
Gm9573 C A 17: 35,623,226 probably benign Het
Gtf2b C A 3: 142,778,255 D63E probably damaging Het
Hydin A G 8: 110,490,611 Y1377C probably damaging Het
Klf1 A G 8: 84,902,095 T41A possibly damaging Het
Lce3d G A 3: 92,958,234 S52N unknown Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrfip1 T A 1: 91,122,413 probably null Het
Ltbp4 A C 7: 27,308,944 V1313G probably damaging Het
Morc1 C A 16: 48,479,845 S235* probably null Het
Mr1 T G 1: 155,129,268 *342S probably null Het
Nol4l T A 2: 153,411,764 S630C probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Olfr644 A G 7: 104,068,413 I206T possibly damaging Het
Otof A G 5: 30,371,643 V1807A probably damaging Het
Pde5a T A 3: 122,779,032 V354E possibly damaging Het
Pmfbp1 A T 8: 109,525,191 E355D probably damaging Het
Ppp2r2c A G 5: 36,927,531 D112G probably damaging Het
Prkacb A T 3: 146,751,499 I37N probably damaging Het
Prox2 T C 12: 85,094,574 D285G probably benign Het
Ranbp3l A G 15: 9,011,919 S61G probably benign Het
Rnf214 T A 9: 45,890,898 T289S probably damaging Het
Rnf217 G T 10: 31,505,977 probably null Het
Sc5d A T 9: 42,255,427 M272K probably benign Het
Slco6c1 T C 1: 97,072,901 T542A possibly damaging Het
Sord T A 2: 122,264,055 I308N probably damaging Het
Syvn1 A T 19: 6,051,184 probably benign Het
Tas2r134 A G 2: 51,628,136 H209R probably benign Het
Trak1 T C 9: 121,443,718 V214A possibly damaging Het
Trpm5 C A 7: 143,084,810 E322* probably null Het
Ttf2 T C 3: 100,969,515 T17A probably damaging Het
Vmn2r53 T C 7: 12,582,416 E492G probably benign Het
Xndc1 T C 7: 102,077,887 V161A probably benign Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R7491:Ern2 UTSW 7 122170533 missense probably damaging 1.00
R7544:Ern2 UTSW 7 122173199 missense probably benign 0.06
R7555:Ern2 UTSW 7 122170241 missense probably damaging 1.00
R7843:Ern2 UTSW 7 122173708 missense probably damaging 1.00
R8281:Ern2 UTSW 7 122170260 missense probably damaging 1.00
R8321:Ern2 UTSW 7 122173208 missense probably damaging 1.00
R8377:Ern2 UTSW 7 122181292 nonsense probably null
R8548:Ern2 UTSW 7 122177839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGGGTTCACTCACTAGGG -3'
(R):5'- CATTTGGTGCCAAGGTGGAG -3'

Sequencing Primer
(F):5'- CACTAGGGGTCCTTTTGGGAGAAC -3'
(R):5'- TGAAACGTGGGTGCGATG -3'
Posted On2018-11-06