Incidental Mutation 'R6940:Rnf214'
ID540508
Institutional Source Beutler Lab
Gene Symbol Rnf214
Ensembl Gene ENSMUSG00000042790
Gene Namering finger protein 214
SynonymsD130054N24Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178709.4; MGI:2444451

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6940 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45863425-45906911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45890898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 289 (T289S)
Ref Sequence ENSEMBL: ENSMUSP00000123754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058720] [ENSMUST00000160699] [ENSMUST00000160811] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699] [ENSMUST00000213659]
Predicted Effect probably damaging
Transcript: ENSMUST00000058720
AA Change: T289S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790
AA Change: T289S

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160699
AA Change: T289S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790
AA Change: T289S

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160811
Predicted Effect possibly damaging
Transcript: ENSMUST00000161187
AA Change: T134S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790
AA Change: T134S

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161203
AA Change: T134S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790
AA Change: T134S

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162369
AA Change: T289S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect probably benign
Transcript: ENSMUST00000213659
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (49/49)
Allele List at MGI

All alleles(12) : Targeted(3) Gene trapped(9)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 C A 9: 54,609,097 A667S probably benign Het
Ank2 G A 3: 126,941,972 probably benign Het
Arhgef28 A G 13: 97,965,530 L812P possibly damaging Het
Armc5 C T 7: 128,240,298 R263* probably null Het
Cadps2 A T 6: 23,302,492 V740E probably damaging Het
Cckbr T C 7: 105,434,896 V279A probably benign Het
Cd101 T C 3: 101,003,702 D880G probably damaging Het
Cep350 A T 1: 155,928,551 S929T probably benign Het
Chaf1b G A 16: 93,905,965 R556H probably benign Het
Csn1s1 A T 5: 87,675,023 Q69L possibly damaging Het
Dennd1b T C 1: 139,053,417 probably null Het
Dnah11 T C 12: 118,198,768 D22G probably benign Het
Dnah7a T C 1: 53,631,677 H472R probably benign Het
Dnah7b G A 1: 46,119,268 R337H probably benign Het
Eif2ak3 T C 6: 70,892,402 V691A possibly damaging Het
Ern2 T C 7: 122,186,146 R3G probably benign Het
Fat3 T C 9: 15,916,800 probably null Het
Fnbp4 T C 2: 90,745,514 F20L unknown Het
Gm9573 C A 17: 35,623,226 probably benign Het
Gtf2b C A 3: 142,778,255 D63E probably damaging Het
Hydin A G 8: 110,490,611 Y1377C probably damaging Het
Klf1 A G 8: 84,902,095 T41A possibly damaging Het
Lce3d G A 3: 92,958,234 S52N unknown Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrfip1 T A 1: 91,122,413 probably null Het
Ltbp4 A C 7: 27,308,944 V1313G probably damaging Het
Morc1 C A 16: 48,479,845 S235* probably null Het
Mr1 T G 1: 155,129,268 *342S probably null Het
Nol4l T A 2: 153,411,764 S630C probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Olfr644 A G 7: 104,068,413 I206T possibly damaging Het
Otof A G 5: 30,371,643 V1807A probably damaging Het
Pde5a T A 3: 122,779,032 V354E possibly damaging Het
Pmfbp1 A T 8: 109,525,191 E355D probably damaging Het
Ppp2r2c A G 5: 36,927,531 D112G probably damaging Het
Prkacb A T 3: 146,751,499 I37N probably damaging Het
Prox2 T C 12: 85,094,574 D285G probably benign Het
Ranbp3l A G 15: 9,011,919 S61G probably benign Het
Rnf217 G T 10: 31,505,977 probably null Het
Sc5d A T 9: 42,255,427 M272K probably benign Het
Slco6c1 T C 1: 97,072,901 T542A possibly damaging Het
Sord T A 2: 122,264,055 I308N probably damaging Het
Syvn1 A T 19: 6,051,184 probably benign Het
Tas2r134 A G 2: 51,628,136 H209R probably benign Het
Trak1 T C 9: 121,443,718 V214A possibly damaging Het
Trpm5 C A 7: 143,084,810 E322* probably null Het
Ttf2 T C 3: 100,969,515 T17A probably damaging Het
Vmn2r53 T C 7: 12,582,416 E492G probably benign Het
Xndc1 T C 7: 102,077,887 V161A probably benign Het
Other mutations in Rnf214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Rnf214 APN 9 45899786 missense probably damaging 1.00
IGL02314:Rnf214 APN 9 45899807 missense probably benign 0.00
IGL02604:Rnf214 APN 9 45869543 missense probably damaging 1.00
IGL02739:Rnf214 APN 9 45869474 missense probably benign
Contorted UTSW 9 45868046 nonsense probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0091:Rnf214 UTSW 9 45898493 critical splice acceptor site probably null
R0375:Rnf214 UTSW 9 45899823 missense probably damaging 0.97
R1027:Rnf214 UTSW 9 45899889 missense probably benign
R1850:Rnf214 UTSW 9 45869448 splice site probably benign
R2424:Rnf214 UTSW 9 45899798 missense probably damaging 0.99
R3751:Rnf214 UTSW 9 45867603 missense probably damaging 1.00
R3772:Rnf214 UTSW 9 45866634 missense possibly damaging 0.83
R4164:Rnf214 UTSW 9 45871912 missense probably damaging 0.99
R4969:Rnf214 UTSW 9 45896188 missense probably damaging 1.00
R5032:Rnf214 UTSW 9 45899744 critical splice donor site probably null
R5647:Rnf214 UTSW 9 45868046 nonsense probably null
R5849:Rnf214 UTSW 9 45868088 missense probably damaging 1.00
R5894:Rnf214 UTSW 9 45866618 missense probably damaging 1.00
R6296:Rnf214 UTSW 9 45867821 missense probably benign 0.05
R6467:Rnf214 UTSW 9 45867588 missense probably damaging 0.97
R6533:Rnf214 UTSW 9 45900063 missense probably benign 0.00
R6621:Rnf214 UTSW 9 45896170 missense probably damaging 1.00
R6801:Rnf214 UTSW 9 45896105 missense probably damaging 1.00
R7398:Rnf214 UTSW 9 45867547 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAAGCAATGGAACTGGCCCTG -3'
(R):5'- GGCTCTTGTTCCGAACCATAG -3'

Sequencing Primer
(F):5'- GCCCTGCCACACAAACAC -3'
(R):5'- TCTTGTTCCGAACCATAGCAACAC -3'
Posted On2018-11-06