Incidental Mutation 'R6941:Kcnq5'
ID540521
Institutional Source Beutler Lab
Gene Symbol Kcnq5
Ensembl Gene ENSMUSG00000028033
Gene Namepotassium voltage-gated channel, subfamily Q, member 5
Synonyms9230107O05Rik, D1Mgi1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location21398403-21961942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21405844 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 545 (Y545C)
Ref Sequence ENSEMBL: ENSMUSP00000134076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029667] [ENSMUST00000115300] [ENSMUST00000173058] [ENSMUST00000173404] [ENSMUST00000174183]
Predicted Effect probably damaging
Transcript: ENSMUST00000029667
AA Change: Y554C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029667
Gene: ENSMUSG00000028033
AA Change: Y554C

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 1.7e-26 PFAM
Pfam:Ion_trans_2 272 352 5.3e-15 PFAM
Pfam:KCNQ_channel 446 648 3.6e-95 PFAM
low complexity region 848 858 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115300
AA Change: Y573C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110955
Gene: ENSMUSG00000028033
AA Change: Y573C

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
Pfam:Ion_trans 126 359 4.1e-28 PFAM
Pfam:Ion_trans_2 272 352 3.3e-16 PFAM
Pfam:KCNQ_channel 467 661 1.8e-98 PFAM
low complexity region 867 877 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173058
AA Change: Y444C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134166
Gene: ENSMUSG00000028033
AA Change: Y444C

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2e-26 PFAM
Pfam:Ion_trans_2 272 352 3.1e-15 PFAM
Pfam:KCNQ_channel 405 538 8e-64 PFAM
low complexity region 738 748 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173404
AA Change: Y545C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134076
Gene: ENSMUSG00000028033
AA Change: Y545C

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2.4e-26 PFAM
Pfam:Ion_trans_2 272 352 3.6e-15 PFAM
Pfam:KCNQ_channel 437 639 2e-95 PFAM
low complexity region 839 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174183
SMART Domains Protein: ENSMUSP00000134389
Gene: ENSMUSG00000028033

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a dominant negative knock-in mutation in this gene exhibit partial prenatal lethality and abnormal afterhyperpolarization in the in the CA3 area of hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Kcnq5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Kcnq5 APN 1 21505763 missense probably damaging 1.00
IGL01603:Kcnq5 APN 1 21505340 missense possibly damaging 0.94
IGL02326:Kcnq5 APN 1 21402592 missense probably benign 0.17
IGL02624:Kcnq5 APN 1 21402430 missense probably benign 0.27
IGL03151:Kcnq5 APN 1 21535069 missense probably damaging 1.00
IGL03367:Kcnq5 APN 1 21403065 missense probably damaging 1.00
PIT1430001:Kcnq5 UTSW 1 21535181 missense probably damaging 1.00
R0705:Kcnq5 UTSW 1 21535177 missense probably damaging 1.00
R0798:Kcnq5 UTSW 1 21961175 splice site probably null
R1263:Kcnq5 UTSW 1 21479378 missense probably damaging 1.00
R1445:Kcnq5 UTSW 1 21405024 missense probably benign 0.01
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1497:Kcnq5 UTSW 1 21402386 missense possibly damaging 0.82
R1515:Kcnq5 UTSW 1 21402681 missense probably benign 0.01
R1610:Kcnq5 UTSW 1 21457461 missense probably damaging 1.00
R1835:Kcnq5 UTSW 1 21466387 missense probably benign 0.04
R1999:Kcnq5 UTSW 1 21402204 missense probably null 0.18
R2060:Kcnq5 UTSW 1 21461597 missense probably benign 0.06
R2145:Kcnq5 UTSW 1 21505349 missense probably damaging 0.96
R2314:Kcnq5 UTSW 1 21479371 splice site probably null
R2511:Kcnq5 UTSW 1 21505782 nonsense probably null
R2697:Kcnq5 UTSW 1 21479432 missense probably damaging 1.00
R2886:Kcnq5 UTSW 1 21469547 nonsense probably null
R2889:Kcnq5 UTSW 1 21402302 missense probably damaging 0.98
R4176:Kcnq5 UTSW 1 21535168 missense probably damaging 1.00
R4609:Kcnq5 UTSW 1 21405068 splice site probably null
R4720:Kcnq5 UTSW 1 21403050 missense probably damaging 0.96
R4904:Kcnq5 UTSW 1 21424100 missense probably damaging 0.98
R5184:Kcnq5 UTSW 1 21402487 missense probably damaging 1.00
R5268:Kcnq5 UTSW 1 21505725 missense probably damaging 1.00
R5373:Kcnq5 UTSW 1 21961571 missense unknown
R5397:Kcnq5 UTSW 1 21405856 missense probably damaging 1.00
R5473:Kcnq5 UTSW 1 21457402 critical splice donor site probably null
R5490:Kcnq5 UTSW 1 21479468 missense probably damaging 1.00
R5946:Kcnq5 UTSW 1 21505707 missense probably damaging 1.00
R6962:Kcnq5 UTSW 1 21505793 missense probably damaging 1.00
R7201:Kcnq5 UTSW 1 21402875 missense possibly damaging 0.93
R7238:Kcnq5 UTSW 1 21402302 missense probably benign 0.39
R7375:Kcnq5 UTSW 1 21469486 missense possibly damaging 0.82
R7584:Kcnq5 UTSW 1 21402321 missense probably benign
Z1088:Kcnq5 UTSW 1 21457529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGTACCACTAACCTTCTC -3'
(R):5'- AAGCAAGTCTCCTAACACTGAGTTG -3'

Sequencing Primer
(F):5'- CCTTCTCTCCATTTACGAAAAGAAG -3'
(R):5'- CTGCCTTGGCCTCTAGAGTAAG -3'
Posted On2018-11-06