Incidental Mutation 'R6941:Pigr'
ID540523
Institutional Source Beutler Lab
Gene Symbol Pigr
Ensembl Gene ENSMUSG00000026417
Gene Namepolymeric immunoglobulin receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130826684-130852249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130847327 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 497 (W497L)
Ref Sequence ENSEMBL: ENSMUSP00000027675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]
PDB Structure
Crystal structure of the 1st Ig domain from mouse Polymeric Immunoglobulin receptor [PSI-NYSGRC-006220] [X-RAY DIFFRACTION]
Crystal structure of the second Ig domain from mouse Polymeric Immunoglobulin receptor [PSI-NYSGRC-006220] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027675
AA Change: W497L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: W497L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
IG 137 238 8.1e-8 SMART
IG 242 346 1.4e-3 SMART
IG 355 457 3.1e-5 SMART
IG 469 563 1e-10 SMART
IG_like 483 548 8e-3 SMART
low complexity region 627 644 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133792
SMART Domains Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
Blast:IG 137 210 3e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137782
SMART Domains Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 3.91e-6 SMART
Blast:IG 137 201 4e-40 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Pigr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pigr APN 1 130834430 start codon destroyed probably null 1.00
IGL01565:Pigr APN 1 130844474 missense possibly damaging 0.93
IGL01592:Pigr APN 1 130849058 missense probably damaging 1.00
IGL02153:Pigr APN 1 130849056 unclassified probably null
IGL02508:Pigr APN 1 130850858 missense probably benign 0.02
IGL02815:Pigr APN 1 130841821 missense probably damaging 1.00
R0834:Pigr UTSW 1 130844544 nonsense probably null
R1453:Pigr UTSW 1 130841544 missense probably benign 0.00
R1728:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1729:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1730:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1736:Pigr UTSW 1 130841803 missense possibly damaging 0.92
R1739:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1742:Pigr UTSW 1 130845086 missense probably damaging 1.00
R1762:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1783:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1784:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1785:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1929:Pigr UTSW 1 130846662 unclassified probably benign
R2065:Pigr UTSW 1 130850880 missense probably benign 0.20
R2275:Pigr UTSW 1 130846470 missense probably benign 0.00
R2513:Pigr UTSW 1 130846620 missense possibly damaging 0.71
R2910:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2911:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2964:Pigr UTSW 1 130841535 missense probably damaging 1.00
R3857:Pigr UTSW 1 130847261 missense probably benign 0.06
R4165:Pigr UTSW 1 130841817 missense probably benign 0.26
R4166:Pigr UTSW 1 130841817 missense probably benign 0.26
R4303:Pigr UTSW 1 130841817 missense probably benign 0.26
R4735:Pigr UTSW 1 130846554 missense probably damaging 0.99
R4909:Pigr UTSW 1 130848458 missense possibly damaging 0.77
R4993:Pigr UTSW 1 130841817 missense probably benign 0.26
R4994:Pigr UTSW 1 130841817 missense probably benign 0.26
R5033:Pigr UTSW 1 130844699 missense probably damaging 1.00
R5116:Pigr UTSW 1 130849031 missense probably benign 0.00
R5304:Pigr UTSW 1 130849493 missense probably benign 0.00
R5440:Pigr UTSW 1 130849622 splice site probably null
R5853:Pigr UTSW 1 130846604 nonsense probably null
R5934:Pigr UTSW 1 130844527 missense probably damaging 0.98
R6015:Pigr UTSW 1 130847261 missense probably benign 0.06
R6291:Pigr UTSW 1 130841761 missense probably benign 0.06
R6749:Pigr UTSW 1 130846548 missense probably benign 0.14
R7369:Pigr UTSW 1 130841766 missense probably benign 0.00
R7391:Pigr UTSW 1 130849566 missense probably damaging 1.00
R7564:Pigr UTSW 1 130841666 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGTGTCAGGGGAAATATGCAC -3'
(R):5'- GTTTCTCCATAGGTCTGGCC -3'

Sequencing Primer
(F):5'- TGTCAGGGGAAATATGCACCATAC -3'
(R):5'- GGTCTGGCCTTGCTTTACC -3'
Posted On2018-11-06