Incidental Mutation 'R6941:Ppp1r16b'
ID540527
Institutional Source Beutler Lab
Gene Symbol Ppp1r16b
Ensembl Gene ENSMUSG00000037754
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16B
SynonymsC130078N17Rik, Wdt4, ANKRD4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158665398-158766334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158696148 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 5 (K5M)
Ref Sequence ENSEMBL: ENSMUSP00000117310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
Predicted Effect probably damaging
Transcript: ENSMUST00000045503
AA Change: K63M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: K63M

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052927
AA Change: K63M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: K63M

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103116
AA Change: K63M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: K63M

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145073
AA Change: K5M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: K5M

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Ppp1r16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ppp1r16b APN 2 158756965 missense probably damaging 1.00
IGL01024:Ppp1r16b APN 2 158740816 splice site probably benign
IGL01080:Ppp1r16b APN 2 158757172 missense probably damaging 0.99
IGL02106:Ppp1r16b APN 2 158746531 missense possibly damaging 0.51
IGL03084:Ppp1r16b APN 2 158761493 nonsense probably null
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0190:Ppp1r16b UTSW 2 158696063 missense probably damaging 1.00
R0294:Ppp1r16b UTSW 2 158746603 missense probably damaging 1.00
R1735:Ppp1r16b UTSW 2 158761495 missense possibly damaging 0.94
R1746:Ppp1r16b UTSW 2 158746665 critical splice donor site probably null
R1847:Ppp1r16b UTSW 2 158761435 missense probably damaging 0.99
R2297:Ppp1r16b UTSW 2 158761366 missense possibly damaging 0.88
R2509:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R2923:Ppp1r16b UTSW 2 158756957 missense probably damaging 1.00
R3907:Ppp1r16b UTSW 2 158761490 missense probably benign 0.00
R4344:Ppp1r16b UTSW 2 158749186 missense probably damaging 1.00
R4373:Ppp1r16b UTSW 2 158761765 missense probably damaging 1.00
R4423:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4424:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4425:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4623:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R5436:Ppp1r16b UTSW 2 158757333 intron probably benign
R6029:Ppp1r16b UTSW 2 158755217 missense possibly damaging 0.74
R6119:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
R6816:Ppp1r16b UTSW 2 158761675 missense probably benign 0.00
R7048:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R7101:Ppp1r16b UTSW 2 158761763 missense probably damaging 1.00
R7255:Ppp1r16b UTSW 2 158761391 missense probably benign 0.41
R7490:Ppp1r16b UTSW 2 158761468 missense probably damaging 0.99
X0064:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCAGTCCATCTCTGTGTC -3'
(R):5'- CCTTCCTAATGTGGGCTGATG -3'

Sequencing Primer
(F):5'- CACCATGAGGCTCCAGC -3'
(R):5'- CTGATGGTATGGTGCGCAC -3'
Posted On2018-11-06