Incidental Mutation 'R6941:Lrrc34'
ID540529
Institutional Source Beutler Lab
Gene Symbol Lrrc34
Ensembl Gene ENSMUSG00000027702
Gene Nameleucine rich repeat containing 34
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location30624267-30647869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30624820 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 376 (Y376C)
Ref Sequence ENSEMBL: ENSMUSP00000029252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000192715] [ENSMUST00000195396]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
AA Change: Y376C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702
AA Change: Y376C

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192715
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Lrrc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc34 APN 3 30645245 missense probably benign 0.12
IGL02738:Lrrc34 APN 3 30631292 missense possibly damaging 0.82
IGL02985:Lrrc34 APN 3 30636295 missense probably benign 0.32
IGL02999:Lrrc34 APN 3 30634633 missense probably damaging 0.99
R0367:Lrrc34 UTSW 3 30629993 missense probably benign 0.08
R0761:Lrrc34 UTSW 3 30631276 splice site probably null
R1426:Lrrc34 UTSW 3 30643579 unclassified probably benign
R1980:Lrrc34 UTSW 3 30642741 missense probably benign 0.33
R2215:Lrrc34 UTSW 3 30643529 missense probably benign 0.03
R2414:Lrrc34 UTSW 3 30634562 missense probably benign 0.00
R4379:Lrrc34 UTSW 3 30631375 missense probably damaging 1.00
R5214:Lrrc34 UTSW 3 30636248 nonsense probably null
R5418:Lrrc34 UTSW 3 30642774 missense possibly damaging 0.85
R5662:Lrrc34 UTSW 3 30631324 missense probably benign 0.03
R6736:Lrrc34 UTSW 3 30624859 missense probably benign 0.03
R6809:Lrrc34 UTSW 3 30634600 missense possibly damaging 0.80
R7017:Lrrc34 UTSW 3 30645316 critical splice acceptor site probably null
R7080:Lrrc34 UTSW 3 30634556 missense probably damaging 0.96
R7139:Lrrc34 UTSW 3 30624887 missense probably benign 0.22
R7191:Lrrc34 UTSW 3 30624878 missense possibly damaging 0.61
R7398:Lrrc34 UTSW 3 30643342 missense probably damaging 1.00
R7662:Lrrc34 UTSW 3 30643303 missense probably benign 0.16
R7707:Lrrc34 UTSW 3 30624892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTAAACTTGCCAGCTGC -3'
(R):5'- ACGCAGATTCACAAAGGGATTTAC -3'

Sequencing Primer
(F):5'- CAGCTTTTTCTCGAGAACAAGTACAC -3'
(R):5'- CTGGAATAATACTAAAACTCAGC -3'
Posted On2018-11-06