Incidental Mutation 'R6941:AU018091'
ID540540
Institutional Source Beutler Lab
Gene Symbol AU018091
Ensembl Gene ENSMUSG00000054753
Gene Nameexpressed sequence AU018091
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3154658-3169203 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 3159427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171749] [ENSMUST00000171749] [ENSMUST00000171749] [ENSMUST00000203937]
Predicted Effect probably null
Transcript: ENSMUST00000171749
SMART Domains Protein: ENSMUSP00000126800
Gene: ENSMUSG00000054753

DomainStartEndE-ValueType
Pfam:AA_permease_2 82 504 2.9e-47 PFAM
Pfam:AA_permease 86 481 3.5e-31 PFAM
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 573 593 N/A INTRINSIC
Pfam:AA_permease_C 604 654 9.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171749
SMART Domains Protein: ENSMUSP00000126800
Gene: ENSMUSG00000054753

DomainStartEndE-ValueType
Pfam:AA_permease_2 82 504 2.9e-47 PFAM
Pfam:AA_permease 86 481 3.5e-31 PFAM
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 573 593 N/A INTRINSIC
Pfam:AA_permease_C 604 654 9.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171749
SMART Domains Protein: ENSMUSP00000126800
Gene: ENSMUSG00000054753

DomainStartEndE-ValueType
Pfam:AA_permease_2 82 504 2.9e-47 PFAM
Pfam:AA_permease 86 481 3.5e-31 PFAM
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 573 593 N/A INTRINSIC
Pfam:AA_permease_C 604 654 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203937
SMART Domains Protein: ENSMUSP00000144796
Gene: ENSMUSG00000054753

DomainStartEndE-ValueType
Pfam:AA_permease_2 73 177 7.9e-11 PFAM
Pfam:AA_permease 77 176 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in AU018091
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:AU018091 APN 7 3158763 missense probably benign 0.01
IGL01063:AU018091 APN 7 3162313 missense possibly damaging 0.62
IGL01598:AU018091 APN 7 3162270 missense possibly damaging 0.71
IGL03253:AU018091 APN 7 3164172 missense probably damaging 1.00
IGL03386:AU018091 APN 7 3161267 missense probably damaging 1.00
IGL02835:AU018091 UTSW 7 3169071 missense unknown
R0070:AU018091 UTSW 7 3158898 splice site probably null
R0070:AU018091 UTSW 7 3158898 splice site probably null
R0733:AU018091 UTSW 7 3159161 missense probably damaging 1.00
R1221:AU018091 UTSW 7 3158877 missense probably damaging 1.00
R1467:AU018091 UTSW 7 3164259 missense probably benign 0.01
R1467:AU018091 UTSW 7 3164259 missense probably benign 0.01
R1708:AU018091 UTSW 7 3156344 missense probably damaging 1.00
R1990:AU018091 UTSW 7 3162264 missense probably benign 0.25
R4043:AU018091 UTSW 7 3159122 missense probably damaging 1.00
R4369:AU018091 UTSW 7 3157975 nonsense probably null
R4501:AU018091 UTSW 7 3159079 missense probably benign 0.25
R4595:AU018091 UTSW 7 3158428 missense possibly damaging 0.91
R4853:AU018091 UTSW 7 3156021 missense probably damaging 1.00
R6834:AU018091 UTSW 7 3157955 missense probably benign 0.06
R6836:AU018091 UTSW 7 3164156 missense probably damaging 1.00
R7153:AU018091 UTSW 7 3159513 missense probably benign 0.01
R7196:AU018091 UTSW 7 3163958 missense probably damaging 1.00
R7237:AU018091 UTSW 7 3159166 missense probably benign 0.00
R7366:AU018091 UTSW 7 3156330 missense probably damaging 1.00
R7956:AU018091 UTSW 7 3161255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCCAATGGAATGGAACGC -3'
(R):5'- GCACTATACCAACTCAGCTATTTCC -3'

Sequencing Primer
(F):5'- TGGAATGGAACGCTGGGGAC -3'
(R):5'- CTGGAGCTCACTTTGTAGACCAG -3'
Posted On2018-11-06