Incidental Mutation 'R6941:Klk1b8'
ID540541
Institutional Source Beutler Lab
Gene Symbol Klk1b8
Ensembl Gene ENSMUSG00000063089
Gene Namekallikrein 1-related peptidase b8
SynonymsmGK-8, Klk8, TADG14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43950664-43954941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43952789 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 48 (H48Q)
Ref Sequence ENSEMBL: ENSMUSP00000072063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072204]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072204
AA Change: H48Q

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072063
Gene: ENSMUSG00000063089
AA Change: H48Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.03e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Usp54 T G 14: 20,562,109 I880L probably benign Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Klk1b8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Klk1b8 APN 7 43954786 missense probably benign 0.40
IGL01076:Klk1b8 APN 7 43954855 missense probably damaging 1.00
IGL01685:Klk1b8 APN 7 43954870 missense possibly damaging 0.88
IGL01771:Klk1b8 APN 7 43954866 missense probably damaging 0.99
IGL02272:Klk1b8 APN 7 43952793 missense probably damaging 1.00
IGL02596:Klk1b8 APN 7 43952763 missense probably damaging 1.00
R0789:Klk1b8 UTSW 7 43945727 unclassified probably benign
R1005:Klk1b8 UTSW 7 43954334 nonsense probably null
R1628:Klk1b8 UTSW 7 43954141 splice site probably null
R1688:Klk1b8 UTSW 7 43945805 unclassified probably benign
R1954:Klk1b8 UTSW 7 43953848 splice site probably benign
R4344:Klk1b8 UTSW 7 43945762 unclassified probably benign
R6294:Klk1b8 UTSW 7 43952772 missense probably damaging 1.00
R8925:Klk1b8 UTSW 7 43954782 missense probably damaging 1.00
R8927:Klk1b8 UTSW 7 43954782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCAGGACCAGCCATATATG -3'
(R):5'- AGACTTTCAGCCAGTTCCAC -3'

Sequencing Primer
(F):5'- AGATCCCCTGGCCATGTC -3'
(R):5'- AGCCAGTTCCACTCCACTG -3'
Posted On2018-11-06