Incidental Mutation 'R6942:Large2'
ID540583
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene NameLARGE xylosyl- and glucuronyltransferase 2
Synonyms5730485C17Rik, Gyltl1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6942 (G1)
Quality Score223.009
Status Validated
Chromosome2
Chromosomal Location92365046-92374869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92370822 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 28 (R28H)
Ref Sequence ENSEMBL: ENSMUSP00000135619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
Predicted Effect probably benign
Transcript: ENSMUST00000028650
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068586
AA Change: R6H

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090582
AA Change: R6H

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111284
AA Change: R6H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148352
AA Change: R6H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176289
AA Change: R6H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176339
AA Change: R28H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434
AA Change: R28H

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176774
AA Change: R6H

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176810
AA Change: R6H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434
AA Change: R6H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,261 D273E probably benign Het
Acacb T C 5: 114,191,963 probably null Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cdh23 G A 10: 60,438,856 T483I possibly damaging Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Cyp11b2 G A 15: 74,856,245 probably benign Het
Cyp2j12 A T 4: 96,112,864 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dpp6 G A 5: 27,469,459 V140M possibly damaging Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Fktn G A 4: 53,735,128 probably null Het
Gas7 A T 11: 67,660,151 probably null Het
Grin3b T A 10: 79,976,119 probably null Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Ino80 A G 2: 119,383,502 F1196L probably damaging Het
Iqsec3 C T 6: 121,473,103 C154Y probably damaging Het
Kank1 A T 19: 25,424,173 D1048V possibly damaging Het
Kif2c A G 4: 117,166,378 L379P probably damaging Het
Kpna6 A T 4: 129,651,721 probably null Het
Map4k2 T A 19: 6,346,709 W552R possibly damaging Het
Mark3 A G 12: 111,592,654 I43M probably null Het
Med13l C A 5: 118,745,006 probably null Het
Mtbp T A 15: 55,567,200 Y218N probably damaging Het
Olfr669 C T 7: 104,938,897 R124C possibly damaging Het
Pcdhgb5 T C 18: 37,732,643 L497P probably damaging Het
Pkhd1l1 A G 15: 44,522,629 T1221A probably damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Serpinb9g A T 13: 33,494,905 T253S probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tep1 A G 14: 50,836,737 V1897A possibly damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Tmem70 T A 1: 16,677,156 Y166N probably damaging Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Ttn A G 2: 76,901,846 probably benign Het
Unc79 T A 12: 103,122,445 probably null Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Zfyve16 A T 13: 92,516,631 N815K probably benign Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R1915:Large2 UTSW 2 92365825 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5264:Large2 UTSW 2 92374743 unclassified probably benign
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6727:Large2 UTSW 2 92370870 utr 5 prime probably benign
R7051:Large2 UTSW 2 92367022 missense probably damaging 0.97
R7318:Large2 UTSW 2 92366028 missense probably benign
R7581:Large2 UTSW 2 92370193 missense probably damaging 1.00
R7640:Large2 UTSW 2 92374705 start codon destroyed probably null
Z1176:Large2 UTSW 2 92370198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGTCCATCTGAAAAGAC -3'
(R):5'- TAGTTCGCGATTCTGACCG -3'

Sequencing Primer
(F):5'- GTCCATCTGAAAAGACACGTGGC -3'
(R):5'- ATTCTGACCGGGACCTGACTG -3'
Posted On2018-11-06