Incidental Mutation 'R6942:Cyp2j12'
ID 540588
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Name cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms OTTMUSG00000007939, Cyp2j12-ps
MMRRC Submission 045056-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6942 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 95987555-96029389 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 96001101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000121694]
AlphaFold G3UXT0
Predicted Effect probably null
Transcript: ENSMUST00000097972
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,330,024 (GRCm39) probably null Het
Adap2 A G 11: 80,045,891 (GRCm39) D57G probably benign Het
Atmin G T 8: 117,683,452 (GRCm39) V371F probably benign Het
Cacna1h G T 17: 25,604,013 (GRCm39) A1273E probably benign Het
Cdh23 G A 10: 60,274,635 (GRCm39) T483I possibly damaging Het
Cnot9 T A 1: 74,558,154 (GRCm39) V100E probably damaging Het
Cog2 T A 8: 125,271,875 (GRCm39) V463D probably benign Het
Crybg3 C T 16: 59,360,183 (GRCm39) R2500H possibly damaging Het
Cyp11b2 G A 15: 74,728,094 (GRCm39) probably benign Het
Dipk1c A C 18: 84,748,549 (GRCm39) Y49S possibly damaging Het
Dlc1 T C 8: 37,405,364 (GRCm39) K142E probably benign Het
Dpp6 G A 5: 27,674,457 (GRCm39) V140M possibly damaging Het
Fktn G A 4: 53,735,128 (GRCm39) probably null Het
Gas7 A T 11: 67,550,977 (GRCm39) probably null Het
Grin3b T A 10: 79,811,953 (GRCm39) probably null Het
Hhatl G A 9: 121,617,246 (GRCm39) A329V probably benign Het
Homer3 C T 8: 70,744,201 (GRCm39) T276I probably benign Het
Igdcc4 G A 9: 65,027,550 (GRCm39) S204N probably benign Het
Ino80 A G 2: 119,213,983 (GRCm39) F1196L probably damaging Het
Iqsec3 C T 6: 121,450,062 (GRCm39) C154Y probably damaging Het
Kank1 A T 19: 25,401,537 (GRCm39) D1048V possibly damaging Het
Kif2c A G 4: 117,023,575 (GRCm39) L379P probably damaging Het
Kpna6 A T 4: 129,545,514 (GRCm39) probably null Het
Large2 C T 2: 92,201,167 (GRCm39) R28H probably damaging Het
Map4k2 T A 19: 6,396,739 (GRCm39) W552R possibly damaging Het
Mark3 A G 12: 111,559,088 (GRCm39) I43M probably null Het
Med13l C A 5: 118,883,071 (GRCm39) probably null Het
Mtbp T A 15: 55,430,596 (GRCm39) Y218N probably damaging Het
Or52n5 C T 7: 104,588,104 (GRCm39) R124C possibly damaging Het
Pcdhgb5 T C 18: 37,865,696 (GRCm39) L497P probably damaging Het
Pkhd1l1 A G 15: 44,386,025 (GRCm39) T1221A probably damaging Het
Pth1r C T 9: 110,557,084 (GRCm39) probably null Het
Samd8 T C 14: 21,825,221 (GRCm39) I59T possibly damaging Het
Scgb2b18 A G 7: 32,871,564 (GRCm39) V85A possibly damaging Het
Sema6c G T 3: 95,080,519 (GRCm39) V906L probably benign Het
Semp2l2b A T 10: 21,943,160 (GRCm39) D273E probably benign Het
Serpinb9g A T 13: 33,678,888 (GRCm39) T253S probably benign Het
Sipa1l3 T C 7: 29,085,516 (GRCm39) T694A probably damaging Het
Slc8a1 A G 17: 81,715,549 (GRCm39) L828P probably damaging Het
Spry1 T A 3: 37,697,193 (GRCm39) D145E probably benign Het
Stat6 A T 10: 127,487,131 (GRCm39) N213Y probably damaging Het
Tep1 A G 14: 51,074,194 (GRCm39) V1897A possibly damaging Het
Tmem45a T C 16: 56,646,145 (GRCm39) N25S probably benign Het
Tmem70 T A 1: 16,747,380 (GRCm39) Y166N probably damaging Het
Trrap T A 5: 144,720,853 (GRCm39) I230N possibly damaging Het
Ttn A G 2: 76,732,190 (GRCm39) probably benign Het
Unc79 T A 12: 103,088,704 (GRCm39) probably null Het
Vmn1r43 T A 6: 89,847,319 (GRCm39) I56F probably benign Het
Zfyve16 A T 13: 92,653,139 (GRCm39) N815K probably benign Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 95,994,826 (GRCm39) splice site probably benign
IGL01655:Cyp2j12 APN 4 96,003,814 (GRCm39) missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 95,990,363 (GRCm39) missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96,010,895 (GRCm39) makesense probably null
IGL01936:Cyp2j12 APN 4 96,021,306 (GRCm39) missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 95,987,999 (GRCm39) missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96,021,231 (GRCm39) critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96,029,262 (GRCm39) missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 95,990,316 (GRCm39) missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96,001,099 (GRCm39) splice site probably benign
R1016:Cyp2j12 UTSW 4 96,001,102 (GRCm39) critical splice donor site probably null
R1251:Cyp2j12 UTSW 4 96,003,903 (GRCm39) nonsense probably null
R1753:Cyp2j12 UTSW 4 96,009,669 (GRCm39) splice site probably null
R2258:Cyp2j12 UTSW 4 96,021,315 (GRCm39) missense probably damaging 1.00
R4471:Cyp2j12 UTSW 4 96,021,306 (GRCm39) missense probably benign 0.01
R4559:Cyp2j12 UTSW 4 96,001,194 (GRCm39) missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96,021,230 (GRCm39) critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 95,990,346 (GRCm39) missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 95,990,388 (GRCm39) splice site probably null
R5591:Cyp2j12 UTSW 4 96,029,359 (GRCm39) start gained probably benign
R5897:Cyp2j12 UTSW 4 95,990,279 (GRCm39) missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96,029,074 (GRCm39) missense probably damaging 0.99
R7422:Cyp2j12 UTSW 4 96,029,222 (GRCm39) missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 95,990,363 (GRCm39) missense possibly damaging 0.95
R7839:Cyp2j12 UTSW 4 95,987,893 (GRCm39) missense possibly damaging 0.94
R8437:Cyp2j12 UTSW 4 95,987,899 (GRCm39) missense probably damaging 1.00
R8445:Cyp2j12 UTSW 4 96,021,259 (GRCm39) missense possibly damaging 0.82
R8683:Cyp2j12 UTSW 4 96,009,805 (GRCm39) missense probably benign 0.41
R8701:Cyp2j12 UTSW 4 96,009,810 (GRCm39) missense possibly damaging 0.81
R8864:Cyp2j12 UTSW 4 96,009,750 (GRCm39) missense probably damaging 1.00
R8924:Cyp2j12 UTSW 4 95,994,685 (GRCm39) missense probably damaging 1.00
R9330:Cyp2j12 UTSW 4 95,994,791 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTACACCATGAAGGATTTTC -3'
(R):5'- AGAACATCACTGTCCAATGAGAG -3'

Sequencing Primer
(F):5'- CCCTTTAGCCAGATCTTTTGAGGG -3'
(R):5'- GATTCCTTCTAAATGTGTTTGCCAG -3'
Posted On 2018-11-06