Incidental Mutation 'R6942:Cog2'
ID540602
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6942 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124545136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 463 (V463D)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
AA Change: V463D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: V463D

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,261 D273E probably benign Het
Acacb T C 5: 114,191,963 probably null Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cdh23 G A 10: 60,438,856 T483I possibly damaging Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Cyp11b2 G A 15: 74,856,245 probably benign Het
Cyp2j12 A T 4: 96,112,864 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dpp6 G A 5: 27,469,459 V140M possibly damaging Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Fktn G A 4: 53,735,128 probably null Het
Gas7 A T 11: 67,660,151 probably null Het
Grin3b T A 10: 79,976,119 probably null Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Ino80 A G 2: 119,383,502 F1196L probably damaging Het
Iqsec3 C T 6: 121,473,103 C154Y probably damaging Het
Kank1 A T 19: 25,424,173 D1048V possibly damaging Het
Kif2c A G 4: 117,166,378 L379P probably damaging Het
Kpna6 A T 4: 129,651,721 probably null Het
Large2 C T 2: 92,370,822 R28H probably damaging Het
Map4k2 T A 19: 6,346,709 W552R possibly damaging Het
Mark3 A G 12: 111,592,654 I43M probably null Het
Med13l C A 5: 118,745,006 probably null Het
Mtbp T A 15: 55,567,200 Y218N probably damaging Het
Olfr669 C T 7: 104,938,897 R124C possibly damaging Het
Pcdhgb5 T C 18: 37,732,643 L497P probably damaging Het
Pkhd1l1 A G 15: 44,522,629 T1221A probably damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Serpinb9g A T 13: 33,494,905 T253S probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tep1 A G 14: 50,836,737 V1897A possibly damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Tmem70 T A 1: 16,677,156 Y166N probably damaging Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Ttn A G 2: 76,901,846 probably benign Het
Unc79 T A 12: 103,122,445 probably null Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Zfyve16 A T 13: 92,516,631 N815K probably benign Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GATATACCTGTGAGCTGAGGTG -3'
(R):5'- AAGCTCACCCATTCCTGCAG -3'

Sequencing Primer
(F):5'- GCTCCCAGACTTCCTCAGG -3'
(R):5'- ATTCCTGCAGCCTGCCCAG -3'
Posted On2018-11-06