Mutagenetix > Incidental Mutation

Incidental Mutation 'R6942:Cyp11b2'

540620

Institutional Source

Beutler Lab

Gene Symbol

Cyp11b2

Ensembl Gene

ENSMUSG00000022589

Gene Name

cytochrome P450, family 11, subfamily b, polypeptide 2

Synonyms

Cyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6942 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74851010-74856318 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to A at 74856245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167634]

AlphaFold

P15539

Predicted Effect

probably benign
Transcript: ENSMUST00000167634

SMART Domains

Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589

Domain	Start	End	E-Value	Type
low complexity region	22	33	N/A	INTRINSIC
Pfam:p450	44	498	1e-115	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	T	10: 22,067,261	D273E	probably benign	Het
Acacb	T	C	5: 114,191,963		probably null	Het
Adap2	A	G	11: 80,155,065	D57G	probably benign	Het
Atmin	G	T	8: 116,956,713	V371F	probably benign	Het
Cacna1h	G	T	17: 25,385,039	A1273E	probably benign	Het
Cdh23	G	A	10: 60,438,856	T483I	possibly damaging	Het
Cnot9	T	A	1: 74,518,995	V100E	probably damaging	Het
Cog2	T	A	8: 124,545,136	V463D	probably benign	Het
Crybg3	C	T	16: 59,539,820	R2500H	possibly damaging	Het
Cyp2j12	A	T	4: 96,112,864		probably null	Het
Dlc1	T	C	8: 36,938,210	K142E	probably benign	Het
Dpp6	G	A	5: 27,469,459	V140M	possibly damaging	Het
Fam69c	A	C	18: 84,730,424	Y49S	possibly damaging	Het
Fktn	G	A	4: 53,735,128		probably null	Het
Gas7	A	T	11: 67,660,151		probably null	Het
Grin3b	T	A	10: 79,976,119		probably null	Het
Hhatl	G	A	9: 121,788,180	A329V	probably benign	Het
Homer3	C	T	8: 70,291,551	T276I	probably benign	Het
Igdcc4	G	A	9: 65,120,268	S204N	probably benign	Het
Ino80	A	G	2: 119,383,502	F1196L	probably damaging	Het
Iqsec3	C	T	6: 121,473,103	C154Y	probably damaging	Het
Kank1	A	T	19: 25,424,173	D1048V	possibly damaging	Het
Kif2c	A	G	4: 117,166,378	L379P	probably damaging	Het
Kpna6	A	T	4: 129,651,721		probably null	Het
Large2	C	T	2: 92,370,822	R28H	probably damaging	Het
Map4k2	T	A	19: 6,346,709	W552R	possibly damaging	Het
Mark3	A	G	12: 111,592,654	I43M	probably null	Het
Med13l	C	A	5: 118,745,006		probably null	Het
Mtbp	T	A	15: 55,567,200	Y218N	probably damaging	Het
Olfr669	C	T	7: 104,938,897	R124C	possibly damaging	Het
Pcdhgb5	T	C	18: 37,732,643	L497P	probably damaging	Het
Pkhd1l1	A	G	15: 44,522,629	T1221A	probably damaging	Het
Pth1r	C	T	9: 110,728,016		probably null	Het
Samd8	T	C	14: 21,775,153	I59T	possibly damaging	Het
Scgb2b18	A	G	7: 33,172,139	V85A	possibly damaging	Het
Sema6c	G	T	3: 95,173,208	V906L	probably benign	Het
Serpinb9g	A	T	13: 33,494,905	T253S	probably benign	Het
Sipa1l3	T	C	7: 29,386,091	T694A	probably damaging	Het
Slc8a1	A	G	17: 81,408,120	L828P	probably damaging	Het
Spry1	T	A	3: 37,643,044	D145E	probably benign	Het
Stat6	A	T	10: 127,651,262	N213Y	probably damaging	Het
Tep1	A	G	14: 50,836,737	V1897A	possibly damaging	Het
Tmem45a	T	C	16: 56,825,782	N25S	probably benign	Het
Tmem70	T	A	1: 16,677,156	Y166N	probably damaging	Het
Trrap	T	A	5: 144,784,043	I230N	possibly damaging	Het
Ttn	A	G	2: 76,901,846		probably benign	Het
Unc79	T	A	12: 103,122,445		probably null	Het
Vmn1r43	T	A	6: 89,870,337	I56F	probably benign	Het
Zfyve16	A	T	13: 92,516,631	N815K	probably benign	Het

Other mutations in Cyp11b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Cyp11b2	APN	15	74853515	missense	probably benign	0.00
IGL02058:Cyp11b2	APN	15	74853189	missense	probably benign	0.30
IGL02419:Cyp11b2	APN	15	74851055	missense	probably damaging	1.00
IGL03094:Cyp11b2	APN	15	74853037	critical splice donor site	probably null
IGL03237:Cyp11b2	APN	15	74851065	missense	probably benign	0.00
Spargel	UTSW	15	74851432	missense	probably damaging	1.00
stickfigure	UTSW	15	74851570	missense	possibly damaging	0.46
Stringbean	UTSW	15	74853130	missense	probably damaging	1.00
veronica	UTSW	15	74853991	missense	probably damaging	1.00
PIT4243001:Cyp11b2	UTSW	15	74851453	missense	probably damaging	1.00
R0522:Cyp11b2	UTSW	15	74851684	splice site	probably benign
R0674:Cyp11b2	UTSW	15	74855544	missense	probably damaging	1.00
R0837:Cyp11b2	UTSW	15	74853641	missense	probably damaging	1.00
R1386:Cyp11b2	UTSW	15	74851775	critical splice acceptor site	probably null
R1423:Cyp11b2	UTSW	15	74853130	missense	probably damaging	1.00
R1550:Cyp11b2	UTSW	15	74853593	missense	probably benign	0.07
R3437:Cyp11b2	UTSW	15	74855449	missense	probably benign
R3693:Cyp11b2	UTSW	15	74856008	missense	probably benign	0.00
R4447:Cyp11b2	UTSW	15	74855563	missense	probably benign	0.00
R4870:Cyp11b2	UTSW	15	74853146	missense	probably benign	0.00
R4947:Cyp11b2	UTSW	15	74851570	missense	possibly damaging	0.46
R4968:Cyp11b2	UTSW	15	74854005	splice site	probably null
R5115:Cyp11b2	UTSW	15	74855428	critical splice donor site	probably null
R5775:Cyp11b2	UTSW	15	74853478	missense	probably benign	0.02
R6738:Cyp11b2	UTSW	15	74853514	missense	possibly damaging	0.65
R6841:Cyp11b2	UTSW	15	74855491	missense	probably benign	0.00
R6997:Cyp11b2	UTSW	15	74851432	missense	probably damaging	1.00
R7094:Cyp11b2	UTSW	15	74853658	missense	possibly damaging	0.94
R7096:Cyp11b2	UTSW	15	74855988	missense	probably damaging	0.98
R7275:Cyp11b2	UTSW	15	74853991	missense	probably damaging	1.00
R7456:Cyp11b2	UTSW	15	74853530	missense	probably benign	0.01
R7604:Cyp11b2	UTSW	15	74853750	splice site	probably null
R8002:Cyp11b2	UTSW	15	74856032	missense	probably damaging	1.00
R8222:Cyp11b2	UTSW	15	74856210	missense	probably benign	0.03
R8346:Cyp11b2	UTSW	15	74851768	missense	probably damaging	1.00
R8349:Cyp11b2	UTSW	15	74851579	missense	possibly damaging	0.94
R8449:Cyp11b2	UTSW	15	74851579	missense	possibly damaging	0.94
R8537:Cyp11b2	UTSW	15	74856167	missense	probably benign	0.01
R8785:Cyp11b2	UTSW	15	74852112	missense	probably benign	0.44
R8824:Cyp11b2	UTSW	15	74856065	missense	probably damaging	1.00
R9072:Cyp11b2	UTSW	15	74853813	missense	possibly damaging	0.56
R9100:Cyp11b2	UTSW	15	74851146	missense	probably damaging	0.99
R9501:Cyp11b2	UTSW	15	74851112	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATGCATCTCCAGGTGTAG -3'
(R):5'- CTAACCACTAGCAGGCTGTG -3'

Sequencing Primer
(F):5'- AGGATCTGTATCATCTTCAGCCAC -3'
(R):5'- CAGGCTGTGCAGGTGTTAGAG -3'

Posted On

2018-11-06