Incidental Mutation 'R6942:Tmem45a'
ID540621
Institutional Source Beutler Lab
Gene Symbol Tmem45a
Ensembl Gene ENSMUSG00000022754
Gene Nametransmembrane protein 45a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6942 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location56805161-56886166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56825782 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 25 (N25S)
Ref Sequence ENSEMBL: ENSMUSP00000155931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023435] [ENSMUST00000135672] [ENSMUST00000232373]
Predicted Effect probably benign
Transcript: ENSMUST00000023435
AA Change: N25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023435
Gene: ENSMUSG00000022754
AA Change: N25S

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
Pfam:DUF716 119 239 8.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135672
AA Change: N25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000232373
AA Change: N25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,261 D273E probably benign Het
Acacb T C 5: 114,191,963 probably null Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cdh23 G A 10: 60,438,856 T483I possibly damaging Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Cyp11b2 G A 15: 74,856,245 probably benign Het
Cyp2j12 A T 4: 96,112,864 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dpp6 G A 5: 27,469,459 V140M possibly damaging Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Fktn G A 4: 53,735,128 probably null Het
Gas7 A T 11: 67,660,151 probably null Het
Grin3b T A 10: 79,976,119 probably null Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Ino80 A G 2: 119,383,502 F1196L probably damaging Het
Iqsec3 C T 6: 121,473,103 C154Y probably damaging Het
Kank1 A T 19: 25,424,173 D1048V possibly damaging Het
Kif2c A G 4: 117,166,378 L379P probably damaging Het
Kpna6 A T 4: 129,651,721 probably null Het
Large2 C T 2: 92,370,822 R28H probably damaging Het
Map4k2 T A 19: 6,346,709 W552R possibly damaging Het
Mark3 A G 12: 111,592,654 I43M probably null Het
Med13l C A 5: 118,745,006 probably null Het
Mtbp T A 15: 55,567,200 Y218N probably damaging Het
Olfr669 C T 7: 104,938,897 R124C possibly damaging Het
Pcdhgb5 T C 18: 37,732,643 L497P probably damaging Het
Pkhd1l1 A G 15: 44,522,629 T1221A probably damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Serpinb9g A T 13: 33,494,905 T253S probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tep1 A G 14: 50,836,737 V1897A possibly damaging Het
Tmem70 T A 1: 16,677,156 Y166N probably damaging Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Ttn A G 2: 76,901,846 probably benign Het
Unc79 T A 12: 103,122,445 probably null Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Zfyve16 A T 13: 92,516,631 N815K probably benign Het
Other mutations in Tmem45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Tmem45a APN 16 56811565 missense probably benign 0.01
IGL03189:Tmem45a APN 16 56811573 nonsense probably null
R1481:Tmem45a UTSW 16 56811602 missense possibly damaging 0.62
R1698:Tmem45a UTSW 16 56823570 missense probably benign 0.10
R1748:Tmem45a UTSW 16 56822338 missense possibly damaging 0.94
R1759:Tmem45a UTSW 16 56822402 missense probably benign
R1921:Tmem45a UTSW 16 56822302 missense probably benign 0.11
R2277:Tmem45a UTSW 16 56823519 missense probably damaging 1.00
R2279:Tmem45a UTSW 16 56823519 missense probably damaging 1.00
R3899:Tmem45a UTSW 16 56806738 missense probably damaging 1.00
R4941:Tmem45a UTSW 16 56822289 missense possibly damaging 0.62
R5489:Tmem45a UTSW 16 56825711 splice site probably null
R6914:Tmem45a UTSW 16 56825782 missense probably benign 0.00
R7064:Tmem45a UTSW 16 56822404 missense probably benign 0.00
R7197:Tmem45a UTSW 16 56811663 missense probably damaging 0.99
R7746:Tmem45a UTSW 16 56825737 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTAATTGGGTTAAGTACTAAGCAAC -3'
(R):5'- TTGCCAATCTTATAGTAGGAGCTAC -3'

Sequencing Primer
(F):5'- ATGGTCTCCTTACCAGTG -3'
(R):5'- CAATATACTCATAATCCACACAGCAG -3'
Posted On2018-11-06