Mutagenetix > Incidental Mutation

Incidental Mutation 'R6942:Kank1'

540628

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6942 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25424173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1048 (D1048V)

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

AlphaFold

E9Q238

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049400
AA Change: D1020V

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: D1020V

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146647
AA Change: D1048V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: D1048V

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	T	10: 22,067,261	D273E	probably benign	Het
Acacb	T	C	5: 114,191,963		probably null	Het
Adap2	A	G	11: 80,155,065	D57G	probably benign	Het
Atmin	G	T	8: 116,956,713	V371F	probably benign	Het
Cacna1h	G	T	17: 25,385,039	A1273E	probably benign	Het
Cdh23	G	A	10: 60,438,856	T483I	possibly damaging	Het
Cnot9	T	A	1: 74,518,995	V100E	probably damaging	Het
Cog2	T	A	8: 124,545,136	V463D	probably benign	Het
Crybg3	C	T	16: 59,539,820	R2500H	possibly damaging	Het
Cyp11b2	G	A	15: 74,856,245		probably benign	Het
Cyp2j12	A	T	4: 96,112,864		probably null	Het
Dlc1	T	C	8: 36,938,210	K142E	probably benign	Het
Dpp6	G	A	5: 27,469,459	V140M	possibly damaging	Het
Fam69c	A	C	18: 84,730,424	Y49S	possibly damaging	Het
Fktn	G	A	4: 53,735,128		probably null	Het
Gas7	A	T	11: 67,660,151		probably null	Het
Grin3b	T	A	10: 79,976,119		probably null	Het
Hhatl	G	A	9: 121,788,180	A329V	probably benign	Het
Homer3	C	T	8: 70,291,551	T276I	probably benign	Het
Igdcc4	G	A	9: 65,120,268	S204N	probably benign	Het
Ino80	A	G	2: 119,383,502	F1196L	probably damaging	Het
Iqsec3	C	T	6: 121,473,103	C154Y	probably damaging	Het
Kif2c	A	G	4: 117,166,378	L379P	probably damaging	Het
Kpna6	A	T	4: 129,651,721		probably null	Het
Large2	C	T	2: 92,370,822	R28H	probably damaging	Het
Map4k2	T	A	19: 6,346,709	W552R	possibly damaging	Het
Mark3	A	G	12: 111,592,654	I43M	probably null	Het
Med13l	C	A	5: 118,745,006		probably null	Het
Mtbp	T	A	15: 55,567,200	Y218N	probably damaging	Het
Olfr669	C	T	7: 104,938,897	R124C	possibly damaging	Het
Pcdhgb5	T	C	18: 37,732,643	L497P	probably damaging	Het
Pkhd1l1	A	G	15: 44,522,629	T1221A	probably damaging	Het
Pth1r	C	T	9: 110,728,016		probably null	Het
Samd8	T	C	14: 21,775,153	I59T	possibly damaging	Het
Scgb2b18	A	G	7: 33,172,139	V85A	possibly damaging	Het
Sema6c	G	T	3: 95,173,208	V906L	probably benign	Het
Serpinb9g	A	T	13: 33,494,905	T253S	probably benign	Het
Sipa1l3	T	C	7: 29,386,091	T694A	probably damaging	Het
Slc8a1	A	G	17: 81,408,120	L828P	probably damaging	Het
Spry1	T	A	3: 37,643,044	D145E	probably benign	Het
Stat6	A	T	10: 127,651,262	N213Y	probably damaging	Het
Tep1	A	G	14: 50,836,737	V1897A	possibly damaging	Het
Tmem45a	T	C	16: 56,825,782	N25S	probably benign	Het
Tmem70	T	A	1: 16,677,156	Y166N	probably damaging	Het
Trrap	T	A	5: 144,784,043	I230N	possibly damaging	Het
Ttn	A	G	2: 76,901,846		probably benign	Het
Unc79	T	A	12: 103,122,445		probably null	Het
Vmn1r43	T	A	6: 89,870,337	I56F	probably benign	Het
Zfyve16	A	T	13: 92,516,631	N815K	probably benign	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00
R9603:Kank1	UTSW	19	25430925	missense	possibly damaging	0.95
R9680:Kank1	UTSW	19	25410774	missense	probably damaging	1.00
R9746:Kank1	UTSW	19	25409508	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGCCCATTGTAAACTTACCAGG -3'
(R):5'- CTCACATTCTGGAACCTGCAC -3'

Sequencing Primer
(F):5'- GGCCTTCAAATAGACCTTGCTTTGAG -3'
(R):5'- ACATTCTGGAACCTGCACTTCATC -3'

Posted On

2018-11-06