Mutagenetix > Incidental Mutation

Incidental Mutation 'R6943:Itga8'

540636

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R6943 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 12155371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably null
Transcript: ENSMUST00000028106

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	A	5: 125,506,298		probably null	Het
Arhgef1	A	G	7: 24,923,731	I423V	probably benign	Het
Aspm	T	C	1: 139,480,542	L2389P	probably damaging	Het
B4galt1	T	C	4: 40,812,860	M222V	probably benign	Het
Bsn	C	A	9: 108,107,817	G3013C	unknown	Het
Camsap2	T	C	1: 136,304,449	H136R	probably damaging	Het
Ccar1	A	G	10: 62,746,936	V1047A	unknown	Het
Ccdc80	A	G	16: 45,095,082	E67G	probably benign	Het
Ces3b	G	T	8: 105,093,078	G511V	probably damaging	Het
Cops6	T	A	5: 138,163,528	H224Q	probably benign	Het
Dnah5	A	T	15: 28,235,720	D331V	probably damaging	Het
Dupd1	T	C	14: 21,677,067	D171G	probably damaging	Het
Echs1	G	A	7: 140,108,094	T266I	probably damaging	Het
Ehmt2	G	A	17: 34,911,430	C1017Y	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fcgbp	G	A	7: 28,092,052	V913I	probably benign	Het
Foxd4	A	G	19: 24,899,876	F320S	probably damaging	Het
Frmpd4	C	T	X: 167,604,583	R133K	probably damaging	Het
Glmp	A	G	3: 88,326,610	Y258C	probably damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gphn	C	G	12: 78,492,181	S200R	possibly damaging	Het
H2-Q7	T	G	17: 35,439,584	M66R	probably benign	Het
Hivep2	T	A	10: 14,128,314	C219S	probably damaging	Het
Hlcs	A	T	16: 94,141,402	M90K	possibly damaging	Het
Klrk1	T	A	6: 129,621,240	M1L	possibly damaging	Het
Kmo	T	A	1: 175,658,375	F385I	probably benign	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc3c	A	G	11: 98,599,249	D144G	probably damaging	Het
Lyzl4	C	T	9: 121,582,981	W123*	probably null	Het
Map3k1	A	G	13: 111,772,712	S77P	probably benign	Het
Mark1	T	C	1: 184,898,787	T709A	probably damaging	Het
Nbr1	A	T	11: 101,577,951	I878F	probably damaging	Het
Nedd1	A	T	10: 92,711,306	H118Q	probably damaging	Het
Nfatc1	C	T	18: 80,635,555	G873S	probably damaging	Het
Ngly1	T	G	14: 16,283,467	N415K	probably damaging	Het
Nol6	C	A	4: 41,118,962	R677L	probably damaging	Het
Nop9	T	C	14: 55,752,813	V471A	probably benign	Het
Notch4	A	G	17: 34,583,603	N1333D	probably benign	Het
Nsun2	G	A	13: 69,630,033	G478R	probably damaging	Het
Olfr1036	T	C	2: 86,074,920	F60S	probably damaging	Het
Olfr248	T	A	1: 174,391,841	Y257*	probably null	Het
Olfr51	T	A	11: 51,007,326	M118K	probably damaging	Het
Olfr954	A	T	9: 39,461,863	Y144F	probably benign	Het
Pcp4l1	T	C	1: 171,174,453	E46G	possibly damaging	Het
Plek2	T	C	12: 78,889,309		probably null	Het
Rbl1	T	G	2: 157,188,286	I434L	probably benign	Het
Ryr2	A	G	13: 11,566,948	V4777A	possibly damaging	Het
Sgk1	T	C	10: 21,882,694	F19S	probably damaging	Het
Stard9	C	T	2: 120,702,196	A2978V	probably benign	Het
Syne1	T	C	10: 5,083,940	T7711A	probably benign	Het
Taf10	G	A	7: 105,744,176	T48I	probably benign	Het
Tgfbi	T	G	13: 56,637,176	S649A	possibly damaging	Het
Thbs3	T	C	3: 89,224,864	V749A	probably benign	Het
Tmem241	G	T	18: 12,047,584	H218N	possibly damaging	Het
Tmem266	C	T	9: 55,377,567		probably benign	Het
Tnc	T	C	4: 63,982,745	I1586M	probably damaging	Het
Ubr4	T	A	4: 139,437,131	C2676*	probably null	Het
Unc13a	A	T	8: 71,652,377	I747N	probably damaging	Het
Vangl1	A	T	3: 102,165,781		probably benign	Het
Vmn1r184	C	T	7: 26,267,138	T103I	possibly damaging	Het
Vmn1r204	T	C	13: 22,556,304	V35A	probably benign	Het
Vps13b	A	G	15: 35,448,689	H603R	possibly damaging	Het
Zfp105	A	G	9: 122,925,238	D44G	probably benign	Het
Zfp11	T	C	5: 129,658,088	H103R	probably damaging	Het
Zfp335	A	G	2: 164,894,875	F947L	possibly damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGTTGGGGCTATTGATCAAATAACC -3'
(R):5'- GTGCCACATTCTTGCAGCTG -3'

Sequencing Primer
(F):5'- CCTATAGAACTTGGGGAACGCC -3'
(R):5'- GCAGCTGCACAATATTGGAC -3'

Posted On

2018-11-06