Mutagenetix > Incidental Mutation

Incidental Mutation 'R6943:Zfp335'

540640

Institutional Source

Beutler Lab

Gene Symbol

Zfp335

Ensembl Gene

ENSMUSG00000039834

Gene Name

zinc finger protein 335

Synonyms

1810045J01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6943 (G1)

Quality Score

175.009

Status

Not validated

Chromosome

Chromosomal Location

164891882-164911757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 164894875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 947 (F947L)

Ref Sequence

ENSEMBL: ENSMUSP00000038298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]

AlphaFold

A2A5K6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041361
AA Change: F947L

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: F947L

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART
ZnF_C2H2	591	613	2.53e-2	SMART
ZnF_C2H2	622	644	6.78e-3	SMART
ZnF_C2H2	650	673	8.22e-2	SMART
ZnF_C2H2	679	702	3.29e-1	SMART
low complexity region	711	726	N/A	INTRINSIC
internal_repeat_3	770	937	7.16e-5	PROSPERO
low complexity region	1005	1015	N/A	INTRINSIC
ZnF_C2H2	1019	1041	2.95e-3	SMART
ZnF_C2H2	1047	1069	5.5e-3	SMART
ZnF_C2H2	1075	1097	1.58e-3	SMART
ZnF_C2H2	1103	1126	3.34e-2	SMART
low complexity region	1288	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000041643

SMART Domains

Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

Domain	Start	End	E-Value	Type
WW	44	77	4.34e-4	SMART
low complexity region	132	148	N/A	INTRINSIC
Pfam:PCIF1_WW	445	620	7.1e-74	PFAM
low complexity region	675	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183830

SMART Domains

Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	A	5: 125,506,298		probably null	Het
Arhgef1	A	G	7: 24,923,731	I423V	probably benign	Het
Aspm	T	C	1: 139,480,542	L2389P	probably damaging	Het
B4galt1	T	C	4: 40,812,860	M222V	probably benign	Het
Bsn	C	A	9: 108,107,817	G3013C	unknown	Het
Camsap2	T	C	1: 136,304,449	H136R	probably damaging	Het
Ccar1	A	G	10: 62,746,936	V1047A	unknown	Het
Ccdc80	A	G	16: 45,095,082	E67G	probably benign	Het
Ces3b	G	T	8: 105,093,078	G511V	probably damaging	Het
Cops6	T	A	5: 138,163,528	H224Q	probably benign	Het
Dnah5	A	T	15: 28,235,720	D331V	probably damaging	Het
Dupd1	T	C	14: 21,677,067	D171G	probably damaging	Het
Echs1	G	A	7: 140,108,094	T266I	probably damaging	Het
Ehmt2	G	A	17: 34,911,430	C1017Y	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fcgbp	G	A	7: 28,092,052	V913I	probably benign	Het
Foxd4	A	G	19: 24,899,876	F320S	probably damaging	Het
Frmpd4	C	T	X: 167,604,583	R133K	probably damaging	Het
Glmp	A	G	3: 88,326,610	Y258C	probably damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gphn	C	G	12: 78,492,181	S200R	possibly damaging	Het
H2-Q7	T	G	17: 35,439,584	M66R	probably benign	Het
Hivep2	T	A	10: 14,128,314	C219S	probably damaging	Het
Hlcs	A	T	16: 94,141,402	M90K	possibly damaging	Het
Itga8	C	A	2: 12,155,371		probably null	Het
Klrk1	T	A	6: 129,621,240	M1L	possibly damaging	Het
Kmo	T	A	1: 175,658,375	F385I	probably benign	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc3c	A	G	11: 98,599,249	D144G	probably damaging	Het
Lyzl4	C	T	9: 121,582,981	W123*	probably null	Het
Map3k1	A	G	13: 111,772,712	S77P	probably benign	Het
Mark1	T	C	1: 184,898,787	T709A	probably damaging	Het
Nbr1	A	T	11: 101,577,951	I878F	probably damaging	Het
Nedd1	A	T	10: 92,711,306	H118Q	probably damaging	Het
Nfatc1	C	T	18: 80,635,555	G873S	probably damaging	Het
Ngly1	T	G	14: 16,283,467	N415K	probably damaging	Het
Nol6	C	A	4: 41,118,962	R677L	probably damaging	Het
Nop9	T	C	14: 55,752,813	V471A	probably benign	Het
Notch4	A	G	17: 34,583,603	N1333D	probably benign	Het
Nsun2	G	A	13: 69,630,033	G478R	probably damaging	Het
Olfr1036	T	C	2: 86,074,920	F60S	probably damaging	Het
Olfr248	T	A	1: 174,391,841	Y257*	probably null	Het
Olfr51	T	A	11: 51,007,326	M118K	probably damaging	Het
Olfr954	A	T	9: 39,461,863	Y144F	probably benign	Het
Pcp4l1	T	C	1: 171,174,453	E46G	possibly damaging	Het
Plek2	T	C	12: 78,889,309		probably null	Het
Rbl1	T	G	2: 157,188,286	I434L	probably benign	Het
Ryr2	A	G	13: 11,566,948	V4777A	possibly damaging	Het
Sgk1	T	C	10: 21,882,694	F19S	probably damaging	Het
Stard9	C	T	2: 120,702,196	A2978V	probably benign	Het
Syne1	T	C	10: 5,083,940	T7711A	probably benign	Het
Taf10	G	A	7: 105,744,176	T48I	probably benign	Het
Tgfbi	T	G	13: 56,637,176	S649A	possibly damaging	Het
Thbs3	T	C	3: 89,224,864	V749A	probably benign	Het
Tmem241	G	T	18: 12,047,584	H218N	possibly damaging	Het
Tmem266	C	T	9: 55,377,567		probably benign	Het
Tnc	T	C	4: 63,982,745	I1586M	probably damaging	Het
Ubr4	T	A	4: 139,437,131	C2676*	probably null	Het
Unc13a	A	T	8: 71,652,377	I747N	probably damaging	Het
Vangl1	A	T	3: 102,165,781		probably benign	Het
Vmn1r184	C	T	7: 26,267,138	T103I	possibly damaging	Het
Vmn1r204	T	C	13: 22,556,304	V35A	probably benign	Het
Vps13b	A	G	15: 35,448,689	H603R	possibly damaging	Het
Zfp105	A	G	9: 122,925,238	D44G	probably benign	Het
Zfp11	T	C	5: 129,658,088	H103R	probably damaging	Het

Other mutations in Zfp335

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Zfp335	APN	2	164892382	missense	probably damaging	1.00
IGL00921:Zfp335	APN	2	164894776	missense	possibly damaging	0.51
IGL00980:Zfp335	APN	2	164902674	nonsense	probably null
IGL01145:Zfp335	APN	2	164907502	missense	probably benign	0.03
IGL01568:Zfp335	APN	2	164894788	missense	possibly damaging	0.70
IGL01612:Zfp335	APN	2	164910620	critical splice donor site	probably null
IGL02138:Zfp335	APN	2	164893804	missense	probably damaging	1.00
IGL02675:Zfp335	APN	2	164910689	missense	probably benign
IGL03206:Zfp335	APN	2	164892681	splice site	probably benign
IGL03269:Zfp335	APN	2	164900354	missense	probably damaging	1.00
IGL03306:Zfp335	APN	2	164895984	splice site	probably benign
FR4342:Zfp335	UTSW	2	164907465	small insertion	probably benign
FR4342:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907483	small insertion	probably benign
FR4548:Zfp335	UTSW	2	164907472	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907475	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907484	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907478	small insertion	probably benign
PIT4403001:Zfp335	UTSW	2	164893716	missense	possibly damaging	0.56
R0005:Zfp335	UTSW	2	164909302	missense	possibly damaging	0.91
R0101:Zfp335	UTSW	2	164899990	missense	probably damaging	1.00
R0196:Zfp335	UTSW	2	164896145	missense	possibly damaging	0.88
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0533:Zfp335	UTSW	2	164907922	nonsense	probably null
R0865:Zfp335	UTSW	2	164899495	splice site	probably null
R1023:Zfp335	UTSW	2	164892585	missense	possibly damaging	0.88
R1029:Zfp335	UTSW	2	164892678	splice site	probably benign
R1052:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1106:Zfp335	UTSW	2	164907551	small deletion	probably benign
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1274:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1386:Zfp335	UTSW	2	164898241	missense	probably benign	0.00
R1433:Zfp335	UTSW	2	164899456	missense	probably damaging	0.99
R1813:Zfp335	UTSW	2	164892605	missense	probably damaging	0.99
R1959:Zfp335	UTSW	2	164894802	missense	probably damaging	1.00
R2372:Zfp335	UTSW	2	164895039	missense	probably damaging	1.00
R3847:Zfp335	UTSW	2	164900106	splice site	probably null
R3937:Zfp335	UTSW	2	164910700	missense	probably damaging	1.00
R3946:Zfp335	UTSW	2	164892189	missense	probably damaging	1.00
R3979:Zfp335	UTSW	2	164910638	missense	probably benign	0.00
R4019:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4020:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4668:Zfp335	UTSW	2	164900286	missense	probably damaging	1.00
R5000:Zfp335	UTSW	2	164894668	missense	probably benign
R5038:Zfp335	UTSW	2	164910644	nonsense	probably null
R5245:Zfp335	UTSW	2	164894758	missense	probably benign
R5411:Zfp335	UTSW	2	164902245	missense	probably damaging	0.99
R5422:Zfp335	UTSW	2	164907730	missense	probably damaging	1.00
R5968:Zfp335	UTSW	2	164892394	missense	probably damaging	0.99
R6056:Zfp335	UTSW	2	164895098	splice site	probably null
R6551:Zfp335	UTSW	2	164909365	missense	probably benign
R6927:Zfp335	UTSW	2	164893720	missense	probably damaging	1.00
R6995:Zfp335	UTSW	2	164893290	nonsense	probably null
R7174:Zfp335	UTSW	2	164902503	missense	probably damaging	1.00
R7185:Zfp335	UTSW	2	164893244	critical splice donor site	probably null
R7296:Zfp335	UTSW	2	164900132	missense	probably damaging	0.99
R7322:Zfp335	UTSW	2	164910821	start codon destroyed	probably null	0.90
R7504:Zfp335	UTSW	2	164909418	missense	probably benign	0.27
R7560:Zfp335	UTSW	2	164895992	missense	probably damaging	1.00
R7637:Zfp335	UTSW	2	164892539	critical splice donor site	probably null
R8064:Zfp335	UTSW	2	164907700	missense	probably damaging	1.00
R8208:Zfp335	UTSW	2	164893616	critical splice acceptor site	probably null
R8228:Zfp335	UTSW	2	164904898	missense	probably damaging	1.00
R8271:Zfp335	UTSW	2	164898053	missense	probably damaging	0.98
R8688:Zfp335	UTSW	2	164892193	missense	probably damaging	1.00
R8803:Zfp335	UTSW	2	164909370	missense	probably benign	0.14
R9266:Zfp335	UTSW	2	164896087	missense	probably benign	0.33
R9352:Zfp335	UTSW	2	164900322	missense	probably damaging	0.99
R9487:Zfp335	UTSW	2	164893475	missense	probably damaging	0.99
R9752:Zfp335	UTSW	2	164907427	critical splice donor site	probably null
RF031:Zfp335	UTSW	2	164907463	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGAAAACTTCTTTGTTGAGGAAGC -3'
(R):5'- TGAGCGACACTCTCAAGGAG -3'

Sequencing Primer
(F):5'- GATTGGGGTACTACCAGGCCTAG -3'
(R):5'- ACACTCTCAAGGAGGCTGG -3'

Posted On

2018-11-06