Incidental Mutation 'R6943:B4galt1'
ID540644
Institutional Source Beutler Lab
Gene Symbol B4galt1
Ensembl Gene ENSMUSG00000028413
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
SynonymsGalT, Ggtb, beta 1,4-Galactosyltransferase I, Ggtb2, beta-1,4-GalT1, b1,4-Galactosyltransferase I, B-1,4-GalT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6943 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location40804602-40854005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40812860 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 222 (M222V)
Ref Sequence ENSEMBL: ENSMUSP00000030121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030121] [ENSMUST00000108096]
Predicted Effect probably benign
Transcript: ENSMUST00000030121
AA Change: M222V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030121
Gene: ENSMUSG00000028413
AA Change: M222V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 264 3.1e-62 PFAM
Pfam:Glyco_transf_7C 268 346 5.9e-32 PFAM
Pfam:Glyco_tranf_2_2 279 339 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108096
AA Change: M222V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103731
Gene: ENSMUSG00000028413
AA Change: M222V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 266 1.8e-52 PFAM
Pfam:Glyco_transf_7C 268 328 8.7e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes two distinct enzyme isoforms, a long membrane-bound form and a short soluble form. These alternate isoforms are thought to be produced through alternative nested transcription initiation and different in-frame start codon usage. These enzymes catalyze the transfer of galactose to acceptor sugars, such as N-acetylglucosamine and glucose. The long form of this enzyme is localized to the trans-Golgi membrane and is involved in glycoconjugate biosynthesis. The short form functions in lactose biosynthesis though formation of a heterodimer with alpha-lactalbumin. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, low viability, excessive epithelial cell proliferation of skin and small intestine, sperm with reduced fertilizing capacity, birthing difficulty, and mammary gland defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,506,298 probably null Het
Arhgef1 A G 7: 24,923,731 I423V probably benign Het
Aspm T C 1: 139,480,542 L2389P probably damaging Het
Bsn C A 9: 108,107,817 G3013C unknown Het
Camsap2 T C 1: 136,304,449 H136R probably damaging Het
Ccar1 A G 10: 62,746,936 V1047A unknown Het
Ccdc80 A G 16: 45,095,082 E67G probably benign Het
Ces3b G T 8: 105,093,078 G511V probably damaging Het
Cops6 T A 5: 138,163,528 H224Q probably benign Het
Dnah5 A T 15: 28,235,720 D331V probably damaging Het
Dupd1 T C 14: 21,677,067 D171G probably damaging Het
Echs1 G A 7: 140,108,094 T266I probably damaging Het
Ehmt2 G A 17: 34,911,430 C1017Y probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fcgbp G A 7: 28,092,052 V913I probably benign Het
Foxd4 A G 19: 24,899,876 F320S probably damaging Het
Frmpd4 C T X: 167,604,583 R133K probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gphn C G 12: 78,492,181 S200R possibly damaging Het
H2-Q7 T G 17: 35,439,584 M66R probably benign Het
Hivep2 T A 10: 14,128,314 C219S probably damaging Het
Hlcs A T 16: 94,141,402 M90K possibly damaging Het
Itga8 C A 2: 12,155,371 probably null Het
Klrk1 T A 6: 129,621,240 M1L possibly damaging Het
Kmo T A 1: 175,658,375 F385I probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc3c A G 11: 98,599,249 D144G probably damaging Het
Lyzl4 C T 9: 121,582,981 W123* probably null Het
Map3k1 A G 13: 111,772,712 S77P probably benign Het
Mark1 T C 1: 184,898,787 T709A probably damaging Het
Nbr1 A T 11: 101,577,951 I878F probably damaging Het
Nedd1 A T 10: 92,711,306 H118Q probably damaging Het
Nfatc1 C T 18: 80,635,555 G873S probably damaging Het
Ngly1 T G 14: 16,283,467 N415K probably damaging Het
Nol6 C A 4: 41,118,962 R677L probably damaging Het
Nop9 T C 14: 55,752,813 V471A probably benign Het
Notch4 A G 17: 34,583,603 N1333D probably benign Het
Nsun2 G A 13: 69,630,033 G478R probably damaging Het
Olfr1036 T C 2: 86,074,920 F60S probably damaging Het
Olfr248 T A 1: 174,391,841 Y257* probably null Het
Olfr51 T A 11: 51,007,326 M118K probably damaging Het
Olfr954 A T 9: 39,461,863 Y144F probably benign Het
Pcp4l1 T C 1: 171,174,453 E46G possibly damaging Het
Plek2 T C 12: 78,889,309 probably null Het
Rbl1 T G 2: 157,188,286 I434L probably benign Het
Ryr2 A G 13: 11,566,948 V4777A possibly damaging Het
Sgk1 T C 10: 21,882,694 F19S probably damaging Het
Stard9 C T 2: 120,702,196 A2978V probably benign Het
Syne1 T C 10: 5,083,940 T7711A probably benign Het
Taf10 G A 7: 105,744,176 T48I probably benign Het
Tgfbi T G 13: 56,637,176 S649A possibly damaging Het
Thbs3 T C 3: 89,224,864 V749A probably benign Het
Tmem241 G T 18: 12,047,584 H218N possibly damaging Het
Tmem266 C T 9: 55,377,567 probably benign Het
Tnc T C 4: 63,982,745 I1586M probably damaging Het
Ubr4 T A 4: 139,437,131 C2676* probably null Het
Unc13a A T 8: 71,652,377 I747N probably damaging Het
Vangl1 A T 3: 102,165,781 probably benign Het
Vmn1r184 C T 7: 26,267,138 T103I possibly damaging Het
Vmn1r204 T C 13: 22,556,304 V35A probably benign Het
Vps13b A G 15: 35,448,689 H603R possibly damaging Het
Zfp105 A G 9: 122,925,238 D44G probably benign Het
Zfp11 T C 5: 129,658,088 H103R probably damaging Het
Zfp335 A G 2: 164,894,875 F947L possibly damaging Het
Other mutations in B4galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:B4galt1 APN 4 40807760 missense probably damaging 1.00
periwinkle UTSW 4 40807760 missense probably damaging 1.00
R1589:B4galt1 UTSW 4 40823575 missense probably benign 0.28
R3797:B4galt1 UTSW 4 40807258 missense probably benign 0.12
R4419:B4galt1 UTSW 4 40853537 missense probably benign
R4703:B4galt1 UTSW 4 40823569 missense probably benign 0.14
R4727:B4galt1 UTSW 4 40807812 missense probably damaging 1.00
R5706:B4galt1 UTSW 4 40807268 missense probably damaging 0.97
R5903:B4galt1 UTSW 4 40807760 missense probably damaging 1.00
R6860:B4galt1 UTSW 4 40807796 missense probably benign 0.00
R6878:B4galt1 UTSW 4 40809694 missense probably damaging 1.00
R7239:B4galt1 UTSW 4 40812754 missense probably damaging 1.00
R7479:B4galt1 UTSW 4 40823587 missense probably damaging 1.00
R7792:B4galt1 UTSW 4 40809373 missense probably benign 0.00
R7887:B4galt1 UTSW 4 40823501 missense probably benign 0.08
R7923:B4galt1 UTSW 4 40809373 missense probably benign 0.00
R8330:B4galt1 UTSW 4 40812787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAACCCGAACTTGTCCATTGC -3'
(R):5'- CACACATGTCAGCCCTTCTG -3'

Sequencing Primer
(F):5'- TGTCCATTGCAACAGAAATGTGCC -3'
(R):5'- ACTCCTGGAAATGAGGTTGC -3'
Posted On2018-11-06