Incidental Mutation 'R6943:Bsn'
ID 540662
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R6943 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108107817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 3013 (G3013C)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: G3013C
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: G3013C

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124763
AA Change: G241C
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,506,298 probably null Het
Arhgef1 A G 7: 24,923,731 I423V probably benign Het
Aspm T C 1: 139,480,542 L2389P probably damaging Het
B4galt1 T C 4: 40,812,860 M222V probably benign Het
Camsap2 T C 1: 136,304,449 H136R probably damaging Het
Ccar1 A G 10: 62,746,936 V1047A unknown Het
Ccdc80 A G 16: 45,095,082 E67G probably benign Het
Ces3b G T 8: 105,093,078 G511V probably damaging Het
Cops6 T A 5: 138,163,528 H224Q probably benign Het
Dnah5 A T 15: 28,235,720 D331V probably damaging Het
Dupd1 T C 14: 21,677,067 D171G probably damaging Het
Echs1 G A 7: 140,108,094 T266I probably damaging Het
Ehmt2 G A 17: 34,911,430 C1017Y probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fcgbp G A 7: 28,092,052 V913I probably benign Het
Foxd4 A G 19: 24,899,876 F320S probably damaging Het
Frmpd4 C T X: 167,604,583 R133K probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gphn C G 12: 78,492,181 S200R possibly damaging Het
H2-Q7 T G 17: 35,439,584 M66R probably benign Het
Hivep2 T A 10: 14,128,314 C219S probably damaging Het
Hlcs A T 16: 94,141,402 M90K possibly damaging Het
Itga8 C A 2: 12,155,371 probably null Het
Klrk1 T A 6: 129,621,240 M1L possibly damaging Het
Kmo T A 1: 175,658,375 F385I probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc3c A G 11: 98,599,249 D144G probably damaging Het
Lyzl4 C T 9: 121,582,981 W123* probably null Het
Map3k1 A G 13: 111,772,712 S77P probably benign Het
Mark1 T C 1: 184,898,787 T709A probably damaging Het
Nbr1 A T 11: 101,577,951 I878F probably damaging Het
Nedd1 A T 10: 92,711,306 H118Q probably damaging Het
Nfatc1 C T 18: 80,635,555 G873S probably damaging Het
Ngly1 T G 14: 16,283,467 N415K probably damaging Het
Nol6 C A 4: 41,118,962 R677L probably damaging Het
Nop9 T C 14: 55,752,813 V471A probably benign Het
Notch4 A G 17: 34,583,603 N1333D probably benign Het
Nsun2 G A 13: 69,630,033 G478R probably damaging Het
Olfr1036 T C 2: 86,074,920 F60S probably damaging Het
Olfr248 T A 1: 174,391,841 Y257* probably null Het
Olfr51 T A 11: 51,007,326 M118K probably damaging Het
Olfr954 A T 9: 39,461,863 Y144F probably benign Het
Pcp4l1 T C 1: 171,174,453 E46G possibly damaging Het
Plek2 T C 12: 78,889,309 probably null Het
Rbl1 T G 2: 157,188,286 I434L probably benign Het
Ryr2 A G 13: 11,566,948 V4777A possibly damaging Het
Sgk1 T C 10: 21,882,694 F19S probably damaging Het
Stard9 C T 2: 120,702,196 A2978V probably benign Het
Syne1 T C 10: 5,083,940 T7711A probably benign Het
Taf10 G A 7: 105,744,176 T48I probably benign Het
Tgfbi T G 13: 56,637,176 S649A possibly damaging Het
Thbs3 T C 3: 89,224,864 V749A probably benign Het
Tmem241 G T 18: 12,047,584 H218N possibly damaging Het
Tmem266 C T 9: 55,377,567 probably benign Het
Tnc T C 4: 63,982,745 I1586M probably damaging Het
Ubr4 T A 4: 139,437,131 C2676* probably null Het
Unc13a A T 8: 71,652,377 I747N probably damaging Het
Vangl1 A T 3: 102,165,781 probably benign Het
Vmn1r184 C T 7: 26,267,138 T103I possibly damaging Het
Vmn1r204 T C 13: 22,556,304 V35A probably benign Het
Vps13b A G 15: 35,448,689 H603R possibly damaging Het
Zfp105 A G 9: 122,925,238 D44G probably benign Het
Zfp11 T C 5: 129,658,088 H103R probably damaging Het
Zfp335 A G 2: 164,894,875 F947L possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9098:Bsn UTSW 9 108112974 missense possibly damaging 0.65
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9307:Bsn UTSW 9 108115794 missense probably benign 0.01
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108113601 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9563:Bsn UTSW 9 108107417 missense
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTTGGTCCACTACTGCC -3'
(R):5'- CCTTGAAGAACCTCCAGACCTG -3'

Sequencing Primer
(F):5'- CTGCCTGCAGTGTACTGTG -3'
(R):5'- AGGTGCCCTCACAGCTGTATG -3'
Posted On 2018-11-06