Incidental Mutation 'R6943:Nedd1'
ID 540669
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 045057-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R6943 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 92520608-92558282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92547168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 118 (H118Q)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163] [ENSMUST00000216086]
AlphaFold P33215
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: H118Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: H118Q

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,583,362 (GRCm39) probably null Het
Arhgef1 A G 7: 24,623,156 (GRCm39) I423V probably benign Het
Aspm T C 1: 139,408,280 (GRCm39) L2389P probably damaging Het
B4galt1 T C 4: 40,812,860 (GRCm39) M222V probably benign Het
Bsn C A 9: 107,985,016 (GRCm39) G3013C unknown Het
Camsap2 T C 1: 136,232,187 (GRCm39) H136R probably damaging Het
Ccar1 A G 10: 62,582,715 (GRCm39) V1047A unknown Het
Ccdc80 A G 16: 44,915,445 (GRCm39) E67G probably benign Het
Ces3b G T 8: 105,819,710 (GRCm39) G511V probably damaging Het
Cops6 T A 5: 138,161,790 (GRCm39) H224Q probably benign Het
Dnah5 A T 15: 28,235,866 (GRCm39) D331V probably damaging Het
Dusp29 T C 14: 21,727,135 (GRCm39) D171G probably damaging Het
Echs1 G A 7: 139,688,007 (GRCm39) T266I probably damaging Het
Ehmt2 G A 17: 35,130,406 (GRCm39) C1017Y probably damaging Het
Epb41l5 C T 1: 119,536,859 (GRCm39) R344Q probably damaging Het
Fcgbp G A 7: 27,791,477 (GRCm39) V913I probably benign Het
Foxd4 A G 19: 24,877,240 (GRCm39) F320S probably damaging Het
Frmpd4 C T X: 166,387,579 (GRCm39) R133K probably damaging Het
Glmp A G 3: 88,233,917 (GRCm39) Y258C probably damaging Het
Gphn C G 12: 78,538,955 (GRCm39) S200R possibly damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
H2-Q7 T G 17: 35,658,560 (GRCm39) M66R probably benign Het
Hivep2 T A 10: 14,004,058 (GRCm39) C219S probably damaging Het
Hlcs A T 16: 93,942,261 (GRCm39) M90K possibly damaging Het
Itga8 C A 2: 12,160,182 (GRCm39) probably null Het
Klrk1 T A 6: 129,598,203 (GRCm39) M1L possibly damaging Het
Kmo T A 1: 175,485,941 (GRCm39) F385I probably benign Het
Lrit1 G C 14: 36,782,052 (GRCm39) V242L probably damaging Het
Lrrc3c A G 11: 98,490,075 (GRCm39) D144G probably damaging Het
Lyzl4 C T 9: 121,412,047 (GRCm39) W123* probably null Het
Map3k1 A G 13: 111,909,246 (GRCm39) S77P probably benign Het
Mark1 T C 1: 184,630,984 (GRCm39) T709A probably damaging Het
Nbr1 A T 11: 101,468,777 (GRCm39) I878F probably damaging Het
Nfatc1 C T 18: 80,678,770 (GRCm39) G873S probably damaging Het
Ngly1 T G 14: 16,283,467 (GRCm38) N415K probably damaging Het
Nol6 C A 4: 41,118,962 (GRCm39) R677L probably damaging Het
Nop9 T C 14: 55,990,270 (GRCm39) V471A probably benign Het
Notch4 A G 17: 34,802,577 (GRCm39) N1333D probably benign Het
Nsun2 G A 13: 69,778,152 (GRCm39) G478R probably damaging Het
Or10x4 T A 1: 174,219,407 (GRCm39) Y257* probably null Het
Or1ad8 T A 11: 50,898,153 (GRCm39) M118K probably damaging Het
Or5m9b T C 2: 85,905,264 (GRCm39) F60S probably damaging Het
Or8g34 A T 9: 39,373,159 (GRCm39) Y144F probably benign Het
Pcp4l1 T C 1: 171,002,022 (GRCm39) E46G possibly damaging Het
Plek2 T C 12: 78,936,083 (GRCm39) probably null Het
Rbl1 T G 2: 157,030,206 (GRCm39) I434L probably benign Het
Ryr2 A G 13: 11,581,834 (GRCm39) V4777A possibly damaging Het
Sgk1 T C 10: 21,758,593 (GRCm39) F19S probably damaging Het
Stard9 C T 2: 120,532,677 (GRCm39) A2978V probably benign Het
Syne1 T C 10: 5,033,940 (GRCm39) T7711A probably benign Het
Taf10 G A 7: 105,393,383 (GRCm39) T48I probably benign Het
Tgfbi T G 13: 56,784,989 (GRCm39) S649A possibly damaging Het
Thbs3 T C 3: 89,132,171 (GRCm39) V749A probably benign Het
Tmem241 G T 18: 12,180,641 (GRCm39) H218N possibly damaging Het
Tmem266 C T 9: 55,284,851 (GRCm39) probably benign Het
Tnc T C 4: 63,900,982 (GRCm39) I1586M probably damaging Het
Ubr4 T A 4: 139,164,442 (GRCm39) C2676* probably null Het
Unc13a A T 8: 72,105,021 (GRCm39) I747N probably damaging Het
Vangl1 A T 3: 102,073,097 (GRCm39) probably benign Het
Vmn1r184 C T 7: 25,966,563 (GRCm39) T103I possibly damaging Het
Vmn1r204 T C 13: 22,740,474 (GRCm39) V35A probably benign Het
Vps13b A G 15: 35,448,835 (GRCm39) H603R possibly damaging Het
Zfp105 A G 9: 122,754,303 (GRCm39) D44G probably benign Het
Zfp11 T C 5: 129,735,152 (GRCm39) H103R probably damaging Het
Zfp335 A G 2: 164,736,795 (GRCm39) F947L possibly damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92,530,836 (GRCm39) splice site probably benign
IGL00988:Nedd1 APN 10 92,525,548 (GRCm39) missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92,534,031 (GRCm39) critical splice donor site probably null
IGL01588:Nedd1 APN 10 92,522,124 (GRCm39) missense probably benign 0.12
IGL01988:Nedd1 APN 10 92,550,021 (GRCm39) missense probably benign 0.39
IGL02706:Nedd1 APN 10 92,522,147 (GRCm39) missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92,525,519 (GRCm39) nonsense probably null
IGL03011:Nedd1 APN 10 92,525,503 (GRCm39) missense possibly damaging 0.92
Brainless UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R0125:Nedd1 UTSW 10 92,527,791 (GRCm39) missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92,534,745 (GRCm39) missense probably benign 0.30
R0244:Nedd1 UTSW 10 92,552,127 (GRCm39) intron probably benign
R0645:Nedd1 UTSW 10 92,527,693 (GRCm39) splice site probably null
R0791:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92,536,660 (GRCm39) missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92,534,601 (GRCm39) missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92,550,022 (GRCm39) missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92,555,465 (GRCm39) missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92,549,988 (GRCm39) missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92,530,860 (GRCm39) missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92,555,444 (GRCm39) missense probably benign 0.00
R4798:Nedd1 UTSW 10 92,534,772 (GRCm39) missense probably benign 0.00
R4830:Nedd1 UTSW 10 92,522,120 (GRCm39) missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92,530,893 (GRCm39) missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92,547,074 (GRCm39) missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92,522,102 (GRCm39) missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92,552,054 (GRCm39) missense probably benign 0.04
R5534:Nedd1 UTSW 10 92,530,894 (GRCm39) missense probably benign 0.01
R6045:Nedd1 UTSW 10 92,530,962 (GRCm39) nonsense probably null
R6154:Nedd1 UTSW 10 92,534,104 (GRCm39) missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92,527,737 (GRCm39) missense probably benign
R6692:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R7011:Nedd1 UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R7406:Nedd1 UTSW 10 92,547,185 (GRCm39) splice site probably null
R7455:Nedd1 UTSW 10 92,536,787 (GRCm39) missense probably benign 0.01
R7587:Nedd1 UTSW 10 92,534,592 (GRCm39) missense probably benign 0.01
R7745:Nedd1 UTSW 10 92,550,034 (GRCm39) missense probably benign
R8104:Nedd1 UTSW 10 92,527,778 (GRCm39) missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8226:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8925:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
R8927:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCAATACAGGTTGAAGG -3'
(R):5'- ACTCTGTGGACATGTAAGATGGTTC -3'

Sequencing Primer
(F):5'- CAGGTTGAAGGTTGCAATACTTC -3'
(R):5'- GAAACTCTTAGCCCAGGT -3'
Posted On 2018-11-06