Incidental Mutation 'R6943:Frmpd4'
ID540694
Institutional Source Beutler Lab
Gene Symbol Frmpd4
Ensembl Gene ENSMUSG00000049176
Gene NameFERM and PDZ domain containing 4
SynonymsPreso1, Pdzk10, LOC237234, Pdzd10, PKAP1, Preso
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6943 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location167471309-168577231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 167604583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 133 (R133K)
Ref Sequence ENSEMBL: ENSMUSP00000107777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112145] [ENSMUST00000112146] [ENSMUST00000112147] [ENSMUST00000112149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112145
AA Change: R125K

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107773
Gene: ENSMUSG00000049176
AA Change: R125K

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112146
AA Change: R93K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107774
Gene: ENSMUSG00000049176
AA Change: R93K

DomainStartEndE-ValueType
PDZ 45 115 1.38e-12 SMART
B41 162 384 1.86e-49 SMART
low complexity region 702 713 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
Blast:B41 762 832 1e-5 BLAST
low complexity region 833 842 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112147
AA Change: R125K

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107775
Gene: ENSMUSG00000049176
AA Change: R125K

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112149
AA Change: R133K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107777
Gene: ENSMUSG00000049176
AA Change: R133K

DomainStartEndE-ValueType
PDZ 85 155 1.38e-12 SMART
B41 202 424 1.86e-49 SMART
low complexity region 742 753 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
Blast:B41 802 872 1e-5 BLAST
low complexity region 873 882 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain (WW, PDZ, FERM) containing protein. Through its interaction with other proteins (such as PSD-95), it functions as a positive regulator of dendritic spine morphogenesis and density, and is required for the maintenance of excitatory synaptic transmission. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased inflammation-induced pain and thermal pain in a chronic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,506,298 probably null Het
Arhgef1 A G 7: 24,923,731 I423V probably benign Het
Aspm T C 1: 139,480,542 L2389P probably damaging Het
B4galt1 T C 4: 40,812,860 M222V probably benign Het
Bsn C A 9: 108,107,817 G3013C unknown Het
Camsap2 T C 1: 136,304,449 H136R probably damaging Het
Ccar1 A G 10: 62,746,936 V1047A unknown Het
Ccdc80 A G 16: 45,095,082 E67G probably benign Het
Ces3b G T 8: 105,093,078 G511V probably damaging Het
Cops6 T A 5: 138,163,528 H224Q probably benign Het
Dnah5 A T 15: 28,235,720 D331V probably damaging Het
Dupd1 T C 14: 21,677,067 D171G probably damaging Het
Echs1 G A 7: 140,108,094 T266I probably damaging Het
Ehmt2 G A 17: 34,911,430 C1017Y probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fcgbp G A 7: 28,092,052 V913I probably benign Het
Foxd4 A G 19: 24,899,876 F320S probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gphn C G 12: 78,492,181 S200R possibly damaging Het
H2-Q7 T G 17: 35,439,584 M66R probably benign Het
Hivep2 T A 10: 14,128,314 C219S probably damaging Het
Hlcs A T 16: 94,141,402 M90K possibly damaging Het
Itga8 C A 2: 12,155,371 probably null Het
Klrk1 T A 6: 129,621,240 M1L possibly damaging Het
Kmo T A 1: 175,658,375 F385I probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc3c A G 11: 98,599,249 D144G probably damaging Het
Lyzl4 C T 9: 121,582,981 W123* probably null Het
Map3k1 A G 13: 111,772,712 S77P probably benign Het
Mark1 T C 1: 184,898,787 T709A probably damaging Het
Nbr1 A T 11: 101,577,951 I878F probably damaging Het
Nedd1 A T 10: 92,711,306 H118Q probably damaging Het
Nfatc1 C T 18: 80,635,555 G873S probably damaging Het
Ngly1 T G 14: 16,283,467 N415K probably damaging Het
Nol6 C A 4: 41,118,962 R677L probably damaging Het
Nop9 T C 14: 55,752,813 V471A probably benign Het
Notch4 A G 17: 34,583,603 N1333D probably benign Het
Nsun2 G A 13: 69,630,033 G478R probably damaging Het
Olfr1036 T C 2: 86,074,920 F60S probably damaging Het
Olfr248 T A 1: 174,391,841 Y257* probably null Het
Olfr51 T A 11: 51,007,326 M118K probably damaging Het
Olfr954 A T 9: 39,461,863 Y144F probably benign Het
Pcp4l1 T C 1: 171,174,453 E46G possibly damaging Het
Plek2 T C 12: 78,889,309 probably null Het
Rbl1 T G 2: 157,188,286 I434L probably benign Het
Ryr2 A G 13: 11,566,948 V4777A possibly damaging Het
Sgk1 T C 10: 21,882,694 F19S probably damaging Het
Stard9 C T 2: 120,702,196 A2978V probably benign Het
Syne1 T C 10: 5,083,940 T7711A probably benign Het
Taf10 G A 7: 105,744,176 T48I probably benign Het
Tgfbi T G 13: 56,637,176 S649A possibly damaging Het
Thbs3 T C 3: 89,224,864 V749A probably benign Het
Tmem241 G T 18: 12,047,584 H218N possibly damaging Het
Tmem266 C T 9: 55,377,567 probably benign Het
Tnc T C 4: 63,982,745 I1586M probably damaging Het
Ubr4 T A 4: 139,437,131 C2676* probably null Het
Unc13a A T 8: 71,652,377 I747N probably damaging Het
Vangl1 A T 3: 102,165,781 probably benign Het
Vmn1r184 C T 7: 26,267,138 T103I possibly damaging Het
Vmn1r204 T C 13: 22,556,304 V35A probably benign Het
Vps13b A G 15: 35,448,689 H603R possibly damaging Het
Zfp105 A G 9: 122,925,238 D44G probably benign Het
Zfp11 T C 5: 129,658,088 H103R probably damaging Het
Zfp335 A G 2: 164,894,875 F947L possibly damaging Het
Other mutations in Frmpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Frmpd4 APN X 167492935 missense probably damaging 1.00
IGL02476:Frmpd4 APN X 167497855 missense probably damaging 1.00
IGL03142:Frmpd4 APN X 167479483 missense possibly damaging 0.86
IGL03292:Frmpd4 APN X 167477590 missense probably benign
PIT4283001:Frmpd4 UTSW X 167729034 missense possibly damaging 0.95
R0647:Frmpd4 UTSW X 167489010 missense probably damaging 1.00
R1520:Frmpd4 UTSW X 167492953 missense probably damaging 1.00
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2874:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R3729:Frmpd4 UTSW X 167486807 missense probably damaging 0.96
R3731:Frmpd4 UTSW X 167486807 missense probably damaging 0.96
Z1088:Frmpd4 UTSW X 167497840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACCTTTGGCTATAATAATGGAG -3'
(R):5'- GTCCCAAAGAATGCCCTGATG -3'

Sequencing Primer
(F):5'- CTGGGCTCGAACTCAGAAATTCG -3'
(R):5'- CCCAAAGAATGCCCTGATGTTTTTG -3'
Posted On2018-11-06