Mutagenetix > Incidental Mutation

Incidental Mutation 'R6498:Ugt1a10'

540698

Institutional Source

Beutler Lab

Gene Symbol

Ugt1a10

Ensembl Gene

ENSMUSG00000090165

Gene Name

UDP glycosyltransferase 1 family, polypeptide A10

Synonyms

A13

MMRRC Submission

044630-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R6498 (G1)

Quality Score

76.0075

Status

Validated

Chromosome

Chromosomal Location

88055388-88219004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88216140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 361 (H361N)

Ref Sequence

ENSEMBL: ENSMUSP00000108760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113142] [ENSMUST00000113139] [ENSMUST00000173325] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000138182] [ENSMUST00000126203]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000014263
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000049289
AA Change: H363N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: H363N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:UDPGT	28	524	2.2e-247	PFAM
Pfam:Glyco_tran_28_C	363	452	4.5e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058237
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	522	1.5e-234	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073049
AA Change: H365N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960
AA Change: H365N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:UDPGT	30	526	5.8e-241	PFAM
Pfam:Glyco_tran_28_C	365	454	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073772
AA Change: H358N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175
AA Change: H358N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	519	2.3e-232	PFAM
Pfam:Glyco_tran_28_C	358	447	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097659
AA Change: H359N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943
AA Change: H359N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:UDPGT	25	520	6.7e-246	PFAM
Pfam:Glyco_tran_28_C	359	448	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113134
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	2.7e-232	PFAM
Pfam:Glyco_tran_28_C	361	450	4.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113135
AA Change: H361N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.2e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	1e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113137
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	1.3e-231	PFAM
Pfam:Glyco_tran_28_C	361	450	2.8e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113138
AA Change: H361N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: H361N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:UDPGT	27	522	7.3e-229	PFAM
Pfam:Glyco_tran_28_C	363	448	6.6e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113142
AA Change: H360N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	7.3e-231	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113139
AA Change: H360N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675
AA Change: H360N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	3.6e-237	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173325
AA Change: H161N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165
AA Change: H161N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	61	3.4e-10	PFAM
Pfam:UDPGT	59	210	8.9e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140092
AA Change: H95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545
AA Change: H95N

Domain	Start	End	E-Value	Type
Pfam:UDPGT	1	166	9.3e-98	PFAM
Pfam:Glyco_tran_28_C	96	166	4.9e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000150634
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	9.5e-11	PFAM
Pfam:UDPGT	58	207	2e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000138182
AA Change: H136N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165
AA Change: H136N

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	7e-11	PFAM
Pfam:UDPGT	58	207	1.9e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000126203

SMART Domains

Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	4.6e-11	PFAM
Pfam:UDPGT	59	127	8.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124852

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174821

Meta Mutation Damage Score

0.9341

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.9%
20x: 89.8%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	G	11: 110,292,102	N1043T	possibly damaging	Het
Actn2	C	T	13: 12,276,473	E682K	probably damaging	Het
Agtpbp1	A	G	13: 59,477,040	V833A	possibly damaging	Het
Arrb2	G	T	11: 70,439,549	R333L	probably benign	Het
Atp9b	C	T	18: 80,777,015	S135N	probably benign	Het
Cep112	T	A	11: 108,440,531	S135R	probably benign	Het
D630045J12Rik	G	A	6: 38,147,197	R1607*	probably null	Het
Duox1	A	T	2: 122,319,607	S160C	probably damaging	Het
Eogt	A	T	6: 97,135,213	Y160N	probably damaging	Het
Exosc10	T	C	4: 148,573,338	V647A	probably benign	Het
Fbxo44	C	T	4: 148,154,425			Het
Fen1	G	T	19: 10,200,115	R322S	probably damaging	Het
Gls	A	C	1: 52,220,039	N134K	probably benign	Het
Gm13212	T	A	4: 145,622,889	C299S	probably damaging	Het
H2afy2	C	A	10: 61,757,835	V21F	probably damaging	Het
Hspg2	T	C	4: 137,507,801	V82A	possibly damaging	Het
Il33	G	A	19: 29,949,737	E23K	probably benign	Het
Map2k5	C	A	9: 63,286,401	A266S	possibly damaging	Het
Olfr309	T	C	7: 86,307,018	I32V	probably benign	Het
Olfr329-ps	T	A	11: 58,542,582	N298I	probably damaging	Het
Olfr485	C	T	7: 108,159,432	C147Y	probably benign	Het
Pcdh1	G	A	18: 38,197,437	P838S	probably benign	Het
Pcdha5	A	G	18: 36,962,715	E759G	possibly damaging	Het
Pclo	T	C	5: 14,669,491	I1214T	unknown	Het
Per3	T	C	4: 151,029,205	I299V	probably benign	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Synpo2	A	T	3: 123,080,232		probably null	Het
Sys1	G	A	2: 164,464,518	A131T	probably benign	Het
Tekt2	A	G	4: 126,324,305	L138P	probably benign	Het
Tmprss12	T	A	15: 100,285,252	N158K	probably damaging	Het
Tnrc18	A	T	5: 142,732,168	M2177K	unknown	Het
Trim43a	T	A	9: 88,582,342	I102N	probably damaging	Het
Utrn	C	T	10: 12,442,093	C498Y	probably benign	Het
Vmn1r39	A	T	6: 66,804,857	V159D	probably damaging	Het
Vmn1r44	A	G	6: 89,893,580	T103A	probably benign	Het
Wsb1	A	T	11: 79,248,489	V127D	probably damaging	Het

Other mutations in Ugt1a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Ugt1a10	APN	1	88055987	missense	possibly damaging	0.72
IGL02219:Ugt1a10	APN	1	88056058	missense	probably benign	0.00
IGL02511:Ugt1a10	APN	1	88055863	missense	probably damaging	1.00
IGL02990:Ugt1a10	APN	1	88055879	missense	probably damaging	1.00
PIT4142001:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R0201:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0201:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0522:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0525:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0554:Ugt1a10	UTSW	1	88056095	missense	probably damaging	1.00
R0748:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0811:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R0812:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R1129:Ugt1a10	UTSW	1	88055609	missense	probably benign
R1207:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1432:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
R1457:Ugt1a10	UTSW	1	88055711	missense	probably damaging	1.00
R1469:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1972:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R1973:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R2039:Ugt1a10	UTSW	1	88055981	missense	probably benign	0.32
R2307:Ugt1a10	UTSW	1	88055947	missense	probably benign	0.01
R3952:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R3973:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R4232:Ugt1a10	UTSW	1	88056210	missense	probably benign	0.39
R4392:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4393:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4402:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4417:Ugt1a10	UTSW	1	88055995	missense	probably benign
R4474:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4476:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4515:Ugt1a10	UTSW	1	88056197	missense	probably damaging	1.00
R4579:Ugt1a10	UTSW	1	88056116	missense	probably benign
R4582:Ugt1a10	UTSW	1	88055741	missense	possibly damaging	0.90
R4609:Ugt1a10	UTSW	1	88055482	start codon destroyed	possibly damaging	0.92
R4627:Ugt1a10	UTSW	1	88218390	missense	probably damaging	1.00
R4790:Ugt1a10	UTSW	1	88056287	missense	probably damaging	0.98
R4799:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4910:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4915:Ugt1a10	UTSW	1	88055924	missense	probably damaging	1.00
R5110:Ugt1a10	UTSW	1	88056252	splice site	probably null
R5168:Ugt1a10	UTSW	1	88055809	missense	probably benign	0.01
R5329:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R5373:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5374:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5615:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R6727:Ugt1a10	UTSW	1	88056257	splice site	probably null
R6809:Ugt1a10	UTSW	1	88055925	missense	probably damaging	0.98
R6924:Ugt1a10	UTSW	1	88055657	missense	probably damaging	0.99
R6967:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R7913:Ugt1a10	UTSW	1	88055755	missense	probably benign	0.00
R9165:Ugt1a10	UTSW	1	88055787	missense	probably benign	0.00
R9264:Ugt1a10	UTSW	1	88055671	missense	possibly damaging	0.62
R9475:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
S24628:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
X0013:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
Z1088:Ugt1a10	UTSW	1	88055842	missense	probably benign	0.20
Z1190:Ugt1a10	UTSW	1	88216158	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- GACATCTTAGCTTGATTGTGGTCC -3'
(R):5'- CCTACCTCTTGTTGTTGATGACAG -3'

Sequencing Primer
(F):5'- GTGGTCCGTACACATAAGACATTGC -3'
(R):5'- GGGCATTTTCCAAATCATCAGCAG -3'

Posted On

2018-11-09