Incidental Mutation 'R6498:Fbxo44'
ID540699
Institutional Source Beutler Lab
Gene Symbol Fbxo44
Ensembl Gene ENSMUSG00000029001
Gene NameF-box protein 44
SynonymsFBG3, Fbx6a, FBX30, Fbxo6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6498 (G1)
Quality Score150.008
Status Validated
Chromosome4
Chromosomal Location148152800-148160482 bp(-) (GRCm38)
Type of Mutation
DNA Base Change (assembly) C to T at 148154425 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Fbxo44
AlleleSourceChrCoordTypePredicted EffectPPH Score
trompo UTSW 4 148156004 missense probably benign
R0040:Fbxo44 UTSW 4 148158695 missense probably damaging 1.00
R0737:Fbxo44 UTSW 4 148158809 utr 5 prime probably benign
R0850:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R0899:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1169:Fbxo44 UTSW 4 148155976 missense probably benign 0.01
R1423:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1889:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1895:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R3712:Fbxo44 UTSW 4 148156004 missense probably benign
R3774:Fbxo44 UTSW 4 148156594 missense probably damaging 1.00
R3834:Fbxo44 UTSW 4 148156250 missense probably damaging 1.00
R4411:Fbxo44 UTSW 4 148153608 missense probably damaging 1.00
R4810:Fbxo44 UTSW 4 148156446 missense probably damaging 1.00
R5086:Fbxo44 UTSW 4 148156212 missense probably benign 0.00
R5108:Fbxo44 UTSW 4 148158563 missense probably damaging 1.00
R5344:Fbxo44 UTSW 4 148153573 missense probably damaging 0.98
R5423:Fbxo44 UTSW 4 148154229 missense probably benign 0.00
R5930:Fbxo44 UTSW 4 148156595 missense probably damaging 1.00
R6017:Fbxo44 UTSW 4 148158553 missense probably benign 0.17
R6132:Fbxo44 UTSW 4 148156108 missense probably benign 0.10
R7085:Fbxo44 UTSW 4 148158743 missense probably damaging 0.98
R7142:Fbxo44 UTSW 4 148158812 missense unknown
R7374:Fbxo44 UTSW 4 148156637 missense probably benign 0.21
X0017:Fbxo44 UTSW 4 148156223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCGAGAAGAACAGAGGGACA -3'
(R):5'- CAGGACTGAGTTGCCAGTTG -3'

Sequencing Primer
(F):5'- AAGTTCAAGGTCATCCCTGG -3'
(R):5'- AGTTGCCAGTTGATCAGTGAC -3'
Posted On2018-11-09