Incidental Mutation 'R6468:Mgst1'
ID540703
Institutional Source Beutler Lab
Gene Symbol Mgst1
Ensembl Gene ENSMUSG00000008540
Gene Namemicrosomal glutathione S-transferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6468 (G1)
Quality Score140.008
Status Validated
Chromosome6
Chromosomal Location138140316-138156755 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 138141587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118091]
Predicted Effect probably null
Transcript: ENSMUST00000118091
SMART Domains Protein: ENSMUSP00000112923
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 90 224 1.9e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Mgst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Mgst1 APN 6 138147768 missense probably damaging 0.99
R0319:Mgst1 UTSW 6 138156157 missense possibly damaging 0.81
R0613:Mgst1 UTSW 6 138156245 missense probably damaging 1.00
R0634:Mgst1 UTSW 6 138156331 missense probably damaging 1.00
R0730:Mgst1 UTSW 6 138147669 missense probably benign 0.03
R0862:Mgst1 UTSW 6 138147751 missense probably damaging 1.00
R4447:Mgst1 UTSW 6 138141664 intron probably benign
R4569:Mgst1 UTSW 6 138156215 missense probably damaging 0.99
R4644:Mgst1 UTSW 6 138156370 missense probably damaging 1.00
R4701:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R4930:Mgst1 UTSW 6 138153509 missense probably benign 0.00
R5688:Mgst1 UTSW 6 138141800 intron probably benign
R6307:Mgst1 UTSW 6 138150829 missense probably benign 0.44
R6697:Mgst1 UTSW 6 138147753 missense probably damaging 1.00
R6741:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R6755:Mgst1 UTSW 6 138147772 missense probably damaging 0.99
R6791:Mgst1 UTSW 6 138141807 intron probably benign
R7295:Mgst1 UTSW 6 138147756 missense probably benign 0.11
R7440:Mgst1 UTSW 6 138150844 missense probably benign
R7532:Mgst1 UTSW 6 138153506 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGAAAATTGAAGAGTCATGGCCTTG -3'
(R):5'- TGGGATGAAAGACTCCGACAC -3'

Sequencing Primer
(F):5'- GCAGATAGGGCAAACAGTT -3'
(R):5'- TCTACTTTGAAGGAAAGAAGCTTGAG -3'
Posted On2018-11-14