Incidental Mutation 'R6818:Was'
ID 540715
Institutional Source Beutler Lab
Gene Symbol Was
Ensembl Gene ENSMUSG00000031165
Gene Name Wiskott-Aldrich syndrome
Synonyms U42471, Wasp
MMRRC Submission 044930-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R6818 (G1)
Quality Score 117.467
Status Not validated
Chromosome X
Chromosomal Location 7947705-7956730 bp(-) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC to GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC at 7952450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033505]
AlphaFold P70315
Predicted Effect probably benign
Transcript: ENSMUST00000033505
SMART Domains Protein: ENSMUSP00000033505
Gene: ENSMUSG00000031165

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
WH1 41 147 5.3e-42 SMART
low complexity region 174 200 N/A INTRINSIC
low complexity region 227 237 N/A INTRINSIC
PBD 240 276 2.71e-10 SMART
low complexity region 314 321 N/A INTRINSIC
WH2 448 465 6.55e-5 SMART
SCOP:d1ej5a_ 478 510 4e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant females and hemizygous mutant males exhibit reduced numbers of peripheral blood lymphocytes and platelets, but increased numbers of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,865,089 (GRCm39) probably null Het
Acot4 A C 12: 84,088,783 (GRCm39) E210D probably damaging Het
Adamts9 A C 6: 92,882,172 (GRCm39) S476A probably damaging Het
Ajm1 C CTCTA 2: 25,469,733 (GRCm39) probably null Het
Ak1 T A 2: 32,520,385 (GRCm39) M61K probably damaging Het
Ambp G T 4: 63,072,243 (GRCm39) S17* probably null Het
Anxa6 T A 11: 54,870,326 (GRCm39) M662L probably benign Het
Atp11b T C 3: 35,868,329 (GRCm39) I467T possibly damaging Het
B3gat1 G T 9: 26,662,998 (GRCm39) probably benign Het
Bccip T G 7: 133,319,488 (GRCm39) I193S probably damaging Het
Ccdc170 A G 10: 4,491,782 (GRCm39) E401G probably damaging Het
Cldn16 A G 16: 26,296,257 (GRCm39) T78A probably damaging Het
Cldn24 G T 8: 48,275,757 (GRCm39) A194S probably benign Het
Cltc A G 11: 86,595,054 (GRCm39) V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 (GRCm39) probably null Het
Csmd1 C T 8: 16,235,341 (GRCm39) D1161N probably damaging Het
Cuzd1 A G 7: 130,918,394 (GRCm39) V181A probably damaging Het
Dhx30 A G 9: 109,917,099 (GRCm39) I435T probably damaging Het
Dip2b T C 15: 100,091,835 (GRCm39) V858A probably benign Het
Dnmt3b C T 2: 153,528,204 (GRCm39) T822M probably damaging Het
Dock10 A T 1: 80,593,082 (GRCm39) F97I possibly damaging Het
Dock8 T C 19: 25,146,865 (GRCm39) probably null Het
Dvl2 T C 11: 69,900,099 (GRCm39) L631P probably damaging Het
Faf2 T A 13: 54,789,419 (GRCm39) probably null Het
Fat2 T A 11: 55,200,167 (GRCm39) H969L probably benign Het
Fsip2 T A 2: 82,815,544 (GRCm39) V3759E probably benign Het
Gm10985 A C 3: 53,752,674 (GRCm39) Y19S probably damaging Het
Gm973 T C 1: 59,669,328 (GRCm39) L793P probably damaging Het
H2-M1 A G 17: 36,981,327 (GRCm39) I236T probably damaging Het
Hif1a A T 12: 73,992,337 (GRCm39) R765* probably null Het
Htt A G 5: 34,940,111 (GRCm39) K77E probably damaging Het
Ift172 G T 5: 31,423,304 (GRCm39) Q826K probably benign Het
Inafm1 C T 7: 16,007,086 (GRCm39) A44T probably damaging Het
Kctd4 A G 14: 76,200,748 (GRCm39) T240A probably damaging Het
Klk1 A T 7: 43,878,883 (GRCm39) I124F probably damaging Het
Krbox5 A G 13: 67,981,986 (GRCm39) Q66R possibly damaging Het
Kremen1 T C 11: 5,145,051 (GRCm39) T442A probably benign Het
Mei4 T A 9: 81,907,574 (GRCm39) D202E probably benign Het
Mest T A 6: 30,746,286 (GRCm39) D284E probably damaging Het
Nsfl1c T A 2: 151,344,940 (GRCm39) Y95* probably null Het
Or10al5 T A 17: 38,063,315 (GRCm39) V190D possibly damaging Het
Or10am5 T C 7: 6,517,550 (GRCm39) M293V probably damaging Het
Or2ak4 T A 11: 58,648,783 (GRCm39) C97* probably null Het
Or4k38 T G 2: 111,165,659 (GRCm39) I255L probably benign Het
Pgm1 T A 4: 99,820,763 (GRCm39) I220N probably damaging Het
Pirt T A 11: 66,816,719 (GRCm39) V10E possibly damaging Het
Prl7d1 C A 13: 27,898,454 (GRCm39) M19I probably benign Het
Samhd1 T C 2: 156,949,417 (GRCm39) N490D probably benign Het
Scn2a C A 2: 65,519,013 (GRCm39) S413* probably null Het
Serpinb6e A T 13: 34,016,337 (GRCm39) probably null Het
Slitrk5 A G 14: 111,917,726 (GRCm39) D450G probably benign Het
Tchh A G 3: 93,350,718 (GRCm39) T53A probably damaging Het
Tmem44 A T 16: 30,362,039 (GRCm39) probably null Het
Tpm3-rs7 A G 14: 113,552,448 (GRCm39) E114G possibly damaging Het
Treml2 A G 17: 48,609,925 (GRCm39) Y119C probably damaging Het
Ubxn1 T A 19: 8,851,245 (GRCm39) probably null Het
Vmn2r84 A T 10: 130,222,147 (GRCm39) M691K probably benign Het
Vmn2r97 A T 17: 19,168,193 (GRCm39) I816F possibly damaging Het
Wfdc2 T C 2: 164,405,070 (GRCm39) probably null Het
Zscan4-ps3 T C 7: 11,346,986 (GRCm39) S341P probably damaging Het
Other mutations in Was
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Was APN X 7,954,055 (GRCm39) missense probably damaging 1.00
IGL02100:Was APN X 7,956,554 (GRCm39) missense possibly damaging 0.54
R3709:Was UTSW X 7,952,927 (GRCm39) missense probably benign 0.05
R3710:Was UTSW X 7,952,927 (GRCm39) missense probably benign 0.05
R7601:Was UTSW X 7,952,450 (GRCm39) small deletion probably benign
RF012:Was UTSW X 7,952,470 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGGTCCAAAAGTGCACCCC -3'
(R):5'- CTGGTCCTGAAGGTTGTTATCCTAG -3'

Sequencing Primer
(F):5'- TGGTCCCCCAGCTCCAG -3'
(R):5'- TCAGCCTGGTCTACAAAGTG -3'
Posted On 2018-11-16