Incidental Mutation 'R6822:Krt9'
ID540725
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6822 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationsmall deletion (16 aa in frame mutation)
DNA Base Change (assembly) TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC at 100189077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect probably benign
Transcript: ENSMUST00000059707
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Map3k13 G A 16: 21,922,263 S780N probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
droplet UTSW 11 100190788 missense probably damaging 1.00
G1citation:Krt9 UTSW 11 100189077 small deletion probably benign
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
R7805:Krt9 UTSW 11 100192696 missense possibly damaging 0.85
R7817:Krt9 UTSW 11 100189077 small deletion probably benign
R7822:Krt9 UTSW 11 100189077 small deletion probably benign
R7834:Krt9 UTSW 11 100192666 missense probably benign 0.06
R7947:Krt9 UTSW 11 100189077 small deletion probably benign
R7977:Krt9 UTSW 11 100189077 small deletion probably benign
R8943:Krt9 UTSW 11 100189077 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCTGCTTCCTCCTCCATAA -3'
(R):5'- GGATGCCTCAGTTCACACTT -3'

Sequencing Primer
(F):5'- TAACCTCCTCCACTTTTTCCACCATG -3'
(R):5'- GGATGCCTCAGTTCACACTTAAGTC -3'
Posted On2018-11-16