Incidental Mutation 'R6519:Lasp1'
ID540733
Institutional Source Beutler Lab
Gene Symbol Lasp1
Ensembl Gene ENSMUSG00000038366
Gene NameLIM and SH3 protein 1
SynonymsTg(Col1a1-lacZ)1Ngma, Def-4, Tg(11Col1a1)NG, SH3P6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R6519 (G1)
Quality Score72.0074
Status Validated
Chromosome11
Chromosomal Location97799000-97838764 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 97815557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000127033] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000136723] [ENSMUST00000146572] [ENSMUST00000148280] [ENSMUST00000152962] [ENSMUST00000153520] [ENSMUST00000155762]
Predicted Effect probably null
Transcript: ENSMUST00000043843
SMART Domains Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
LIM 4 56 4.34e-15 SMART
NEBU 62 92 1.1e-8 SMART
NEBU 98 128 1.05e-9 SMART
low complexity region 174 180 N/A INTRINSIC
SH3 207 263 8.11e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127033
SMART Domains Protein: ENSMUSP00000127792
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129558
SMART Domains Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129828
SMART Domains Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136723
SMART Domains Protein: ENSMUSP00000114306
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146572
SMART Domains Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
Pfam:Nebulin 31 59 2.1e-12 PFAM
Pfam:Nebulin 67 89 1.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148280
SMART Domains Protein: ENSMUSP00000123050
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
low complexity region 138 144 N/A INTRINSIC
SCOP:d1awj__ 155 186 7e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000152962
SMART Domains Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153520
Predicted Effect probably null
Transcript: ENSMUST00000155762
SMART Domains Protein: ENSMUSP00000119538
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Pfam:Nebulin 4 32 3.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Lasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Lasp1 APN 11 97836190 missense probably damaging 1.00
R0281:Lasp1 UTSW 11 97806851 nonsense probably null
R2126:Lasp1 UTSW 11 97836134 missense probably benign 0.34
R3906:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3908:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3909:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R4908:Lasp1 UTSW 11 97833704 critical splice donor site probably null
R5239:Lasp1 UTSW 11 97799860 missense probably damaging 1.00
R6576:Lasp1 UTSW 11 97833576 missense probably damaging 1.00
R6629:Lasp1 UTSW 11 97806896 nonsense probably null
R7001:Lasp1 UTSW 11 97806833 missense probably damaging 1.00
R8063:Lasp1 UTSW 11 97834131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTGATCTCCACTGCTGTAG -3'
(R):5'- CATGGTGAAGGACTGCTTGG -3'

Sequencing Primer
(F):5'- GCTGTAGAAGTCTCAGCTCTGAC -3'
(R):5'- AAGGACTGCTTGGGATAGTGTC -3'
Posted On2018-11-19