Incidental Mutation 'R6419:Knl1'
ID540737
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6419 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119069003 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 395 (I395K)
Ref Sequence ENSEMBL: ENSMUSP00000118646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: I395K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I395K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: I395K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I395K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: I395K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I395K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
AA Change: I395K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: I395K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Meta Mutation Damage Score 0.1261 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578G10Rik T C 4: 42,812,473 probably benign Het
Abcc2 T A 19: 43,837,508 probably null Het
Adamts12 C T 15: 11,215,673 T260M possibly damaging Het
Adamts20 C T 15: 94,333,675 V878I possibly damaging Het
Adgrl4 A G 3: 151,439,316 E34G probably damaging Het
Asah1 A T 8: 41,343,766 I293N probably damaging Het
B3galt2 A T 1: 143,647,101 E325V possibly damaging Het
Baz1b T A 5: 135,242,494 H1310Q probably benign Het
Ccdc125 T A 13: 100,690,326 N204K probably damaging Het
Cd36 C T 5: 17,797,152 D284N probably benign Het
Cdh12 T C 15: 21,520,397 L316S probably damaging Het
Cenpv T C 11: 62,525,182 K247R probably benign Het
Cldn18 T C 9: 99,692,748 H257R possibly damaging Het
Cnot8 T A 11: 58,114,065 Y197N probably damaging Het
Cog3 A T 14: 75,724,738 C554* probably null Het
Col4a4 A G 1: 82,466,486 probably null Het
Cops5 G A 1: 10,033,307 T158I probably damaging Het
Dhh A G 15: 98,894,401 F242S probably damaging Het
Dot1l T C 10: 80,791,481 V1512A possibly damaging Het
Dstn T G 2: 143,939,987 I116S possibly damaging Het
Egfem1 G A 3: 29,657,249 D326N probably damaging Het
Enpp3 A T 10: 24,808,191 Y52N probably damaging Het
Fam214a G A 9: 75,009,337 S413N probably benign Het
Gabra2 A G 5: 70,962,083 S359P probably benign Het
Gbp7 G A 3: 142,546,453 G599E probably benign Het
Gcat T G 15: 79,036,064 I198S probably damaging Het
Gm8439 A G 4: 120,609,558 K82R unknown Het
Grin2b A G 6: 135,740,967 F709S probably damaging Het
Grm3 T C 5: 9,570,201 N348D probably damaging Het
Hdgfl1 G A 13: 26,770,092 probably benign Het
Hmgxb3 G T 18: 61,152,224 D564E possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Impg1 A G 9: 80,380,018 V305A probably benign Het
Ints7 T A 1: 191,602,302 S313T possibly damaging Het
Lactb2 A T 1: 13,638,235 Y196* probably null Het
Lad1 T C 1: 135,831,892 S509P possibly damaging Het
Ltf T C 9: 111,031,022 F504L possibly damaging Het
Med4 A T 14: 73,513,923 D104V probably damaging Het
Mrpl58 A T 11: 115,410,247 N128Y probably damaging Het
Ndufs2 T C 1: 171,241,099 T54A probably benign Het
Notch2 G T 3: 98,100,389 probably null Het
Ntng1 A T 3: 109,782,853 N424K possibly damaging Het
Ntrk2 G A 13: 58,861,299 W301* probably null Het
Olfr1471 T A 19: 13,445,767 S252T probably benign Het
Otud6b A G 4: 14,822,766 S113P possibly damaging Het
Papd7 A C 13: 69,510,666 M350R possibly damaging Het
Pcdhb20 A G 18: 37,505,555 N378S probably damaging Het
Polr3b T C 10: 84,638,111 S185P possibly damaging Het
Ptprn G A 1: 75,264,037 R31C probably benign Het
Rgsl1 C T 1: 153,822,371 V478M probably damaging Het
Sema6b A T 17: 56,132,784 L19* probably null Het
Slfn8 A G 11: 83,004,055 probably null Het
Spen A T 4: 141,476,310 S1669T unknown Het
Syne2 T C 12: 76,096,966 F1522L probably damaging Het
Tarbp1 C T 8: 126,459,044 A470T possibly damaging Het
Tiam1 C A 16: 89,898,024 E182* probably null Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trip12 C T 1: 84,793,870 A186T probably damaging Het
Ufc1 C T 1: 171,288,956 A147T probably damaging Het
Vmn1r199 A G 13: 22,383,607 K314R possibly damaging Het
Vmn2r13 A T 5: 109,175,219 I68K possibly damaging Het
Vmn2r77 A T 7: 86,811,559 I698F probably damaging Het
Vmn2r86 T C 10: 130,446,926 K607R probably damaging Het
Vwa3b T C 1: 37,157,376 V28A probably benign Het
Wdr19 A G 5: 65,215,893 N166S possibly damaging Het
Wfdc17 G A 11: 83,704,808 G33R probably damaging Het
Zfp330 T G 8: 82,764,916 K209N probably benign Het
Zfp493 A G 13: 67,786,407 T160A probably benign Het
Zfp974 A T 7: 27,911,515 C262S possibly damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACAGTTGATGGAGCTACAGC -3'
(R):5'- TGGTAATGTCCATGCTATCCTC -3'

Sequencing Primer
(F):5'- TCCAGCTCCAGAGAAGAAAACAG -3'
(R):5'- AAATAGTTTTCTCTCTGAGTGGGCC -3'
Posted On2018-11-21