Incidental Mutation 'R6944:Epb41l5'
ID 540742
Institutional Source Beutler Lab
Gene Symbol Epb41l5
Ensembl Gene ENSMUSG00000026383
Gene Name erythrocyte membrane protein band 4.1 like 5
Synonyms E230025E14Rik, 1700030C16Rik, NBL5, Epb4.1l5, Lulu1
MMRRC Submission 045058-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6944 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 119472767-119576730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119536859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 344 (R344Q)
Ref Sequence ENSEMBL: ENSMUSP00000128374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027632] [ENSMUST00000052404] [ENSMUST00000163147] [ENSMUST00000191046]
AlphaFold Q8BGS1
Predicted Effect probably damaging
Transcript: ENSMUST00000027632
AA Change: R344Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027632
Gene: ENSMUSG00000026383
AA Change: R344Q

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052404
AA Change: R344Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058966
Gene: ENSMUSG00000026383
AA Change: R344Q

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
coiled coil region 482 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163147
AA Change: R344Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128374
Gene: ENSMUSG00000026383
AA Change: R344Q

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 420 429 N/A INTRINSIC
coiled coil region 490 520 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191046
AA Change: R344Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140227
Gene: ENSMUSG00000026383
AA Change: R344Q

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Meta Mutation Damage Score 0.3255 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a number of different mutations exhibit prenatal lethality and mesodermal and epithelial-mesenchymal transition defects during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,863,693 (GRCm39) V216G probably damaging Het
Abcb5 T C 12: 118,875,265 (GRCm39) R636G probably benign Het
Ago1 G T 4: 126,354,215 (GRCm39) F198L possibly damaging Het
Ankrd42 C T 7: 92,268,755 (GRCm39) probably null Het
Anxa11 T A 14: 25,875,176 (GRCm39) F274I probably damaging Het
Ascc1 T C 10: 59,849,475 (GRCm39) L122P probably damaging Het
Bptf T C 11: 106,971,649 (GRCm39) S953G probably damaging Het
Chml T A 1: 175,515,727 (GRCm39) N65Y probably damaging Het
Clcc1 A G 3: 108,578,284 (GRCm39) K262E probably damaging Het
Clhc1 T G 11: 29,519,346 (GRCm39) D384E probably damaging Het
Cnot2 G A 10: 116,373,128 (GRCm39) probably benign Het
Cntnap1 T C 11: 101,073,730 (GRCm39) V627A probably damaging Het
Col6a4 A G 9: 105,949,370 (GRCm39) V755A probably damaging Het
Cyp4f18 T A 8: 72,743,738 (GRCm39) I406F probably benign Het
Dclre1a T C 19: 56,533,451 (GRCm39) E381G possibly damaging Het
Dnah1 A G 14: 30,990,861 (GRCm39) Y3153H probably damaging Het
Dnah8 C A 17: 31,013,633 (GRCm39) D3791E probably benign Het
Dnah9 T C 11: 65,975,975 (GRCm39) E1358G possibly damaging Het
Eef1g G A 19: 8,945,656 (GRCm39) R30H probably benign Het
Egln3 A T 12: 54,230,738 (GRCm39) I181N probably benign Het
Entpd6 A G 2: 150,605,519 (GRCm39) T250A probably damaging Het
Fam20b T C 1: 156,515,091 (GRCm39) D258G probably benign Het
Fbxw18 A T 9: 109,531,655 (GRCm39) D21E probably damaging Het
Fbxw21 T C 9: 108,986,603 (GRCm39) E92G probably damaging Het
Fzd6 T A 15: 38,889,212 (GRCm39) M110K possibly damaging Het
Golgb1 C T 16: 36,732,475 (GRCm39) P574L probably benign Het
Gpr153 A G 4: 152,363,820 (GRCm39) E80G probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
Kcnt1 T C 2: 25,767,840 (GRCm39) probably benign Het
Kcnt2 T G 1: 140,511,803 (GRCm39) V962G probably benign Het
Malt1 T C 18: 65,570,991 (GRCm39) V109A probably benign Het
Marchf7 A G 2: 60,064,587 (GRCm39) I288V probably benign Het
Mief1 C T 15: 80,133,644 (GRCm39) R234C probably damaging Het
Morc3 A G 16: 93,667,460 (GRCm39) S613G probably benign Het
Myt1 A G 2: 181,439,387 (GRCm39) E345G possibly damaging Het
Napb T C 2: 148,548,889 (GRCm39) T133A probably benign Het
Nwd1 T C 8: 73,380,162 (GRCm39) V16A possibly damaging Het
Oas1f G A 5: 120,986,247 (GRCm39) E67K probably benign Het
Obscn T C 11: 58,929,756 (GRCm39) K5153R probably damaging Het
Or2w3b T A 11: 58,623,068 (GRCm39) S308C possibly damaging Het
Or5a3 G T 19: 12,400,628 (GRCm39) M318I probably benign Het
Or5g26 C T 2: 85,494,195 (GRCm39) M194I probably benign Het
Or6d12 T C 6: 116,492,791 (GRCm39) F18L possibly damaging Het
Pdcd2 T C 17: 15,745,632 (GRCm39) N185S possibly damaging Het
Pgap1 A T 1: 54,569,320 (GRCm39) W349R probably damaging Het
Prpf39 T A 12: 65,089,454 (GRCm39) V64E probably benign Het
Ptpn13 T A 5: 103,624,857 (GRCm39) W54R probably null Het
Rbms3 G T 9: 116,939,173 (GRCm39) P29Q probably damaging Het
Rnf123 A G 9: 107,940,822 (GRCm39) L679P probably benign Het
Samd4 T A 14: 47,254,092 (GRCm39) D84E possibly damaging Het
Scarf1 T C 11: 75,413,032 (GRCm39) V426A probably benign Het
Slc12a1 A G 2: 125,002,454 (GRCm39) N145D probably damaging Het
Slc2a6 A T 2: 26,916,076 (GRCm39) M99K probably damaging Het
Slc34a2 A T 5: 53,222,225 (GRCm39) I306L probably benign Het
Slx4ip A G 2: 136,910,195 (GRCm39) K397E probably damaging Het
Smr3a C T 5: 88,155,949 (GRCm39) probably benign Het
Spata31h1 A C 10: 82,132,056 (GRCm39) I318R probably benign Het
Spef2 T C 15: 9,592,835 (GRCm39) E1502G probably damaging Het
Sri A T 5: 8,113,365 (GRCm39) T119S probably benign Het
Synrg T A 11: 83,915,912 (GRCm39) L1085H probably damaging Het
Taf7 A T 18: 37,775,910 (GRCm39) L219H probably damaging Het
Tmco3 T A 8: 13,353,729 (GRCm39) V347E probably damaging Het
Tmem8b A T 4: 43,674,465 (GRCm39) I250F probably damaging Het
Tom1l2 A G 11: 60,139,817 (GRCm39) V239A probably damaging Het
Trpm1 T A 7: 63,893,181 (GRCm39) M1011K probably damaging Het
Tspan9 A T 6: 127,942,769 (GRCm39) Y153N probably benign Het
Ttll11 T C 2: 35,642,306 (GRCm39) H675R probably benign Het
Unc50 C T 1: 37,471,743 (GRCm39) T131M probably damaging Het
Vgf T A 5: 137,061,206 (GRCm39) I456N probably damaging Het
Vmn1r223 A G 13: 23,433,483 (GRCm39) I26V unknown Het
Vmn1r39 T C 6: 66,782,205 (GRCm39) M1V probably null Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r14 T C 5: 109,363,925 (GRCm39) T664A probably benign Het
Vmn2r14 G A 5: 109,364,140 (GRCm39) T592I probably benign Het
Vmn2r96 T A 17: 18,817,891 (GRCm39) F489L probably benign Het
Vmn2r-ps158 T C 7: 42,697,393 (GRCm39) F817L possibly damaging Het
Other mutations in Epb41l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Epb41l5 APN 1 119,495,577 (GRCm39) missense probably benign 0.03
IGL01983:Epb41l5 APN 1 119,506,814 (GRCm39) splice site probably benign
IGL02085:Epb41l5 APN 1 119,500,586 (GRCm39) missense probably benign
IGL02834:Epb41l5 APN 1 119,551,685 (GRCm39) missense probably benign 0.22
IGL02975:Epb41l5 APN 1 119,506,811 (GRCm39) splice site probably benign
IGL03001:Epb41l5 APN 1 119,545,374 (GRCm39) missense probably damaging 1.00
IGL03331:Epb41l5 APN 1 119,545,149 (GRCm39) missense probably damaging 1.00
R0096:Epb41l5 UTSW 1 119,551,641 (GRCm39) splice site probably benign
R0124:Epb41l5 UTSW 1 119,561,370 (GRCm39) nonsense probably null
R0128:Epb41l5 UTSW 1 119,477,632 (GRCm39) missense possibly damaging 0.81
R0130:Epb41l5 UTSW 1 119,477,632 (GRCm39) missense possibly damaging 0.81
R0241:Epb41l5 UTSW 1 119,495,509 (GRCm39) splice site probably null
R0357:Epb41l5 UTSW 1 119,536,934 (GRCm39) missense probably damaging 1.00
R0624:Epb41l5 UTSW 1 119,551,688 (GRCm39) missense probably damaging 1.00
R0711:Epb41l5 UTSW 1 119,551,641 (GRCm39) splice site probably benign
R0848:Epb41l5 UTSW 1 119,477,684 (GRCm39) missense probably benign 0.01
R1340:Epb41l5 UTSW 1 119,476,861 (GRCm39) makesense probably null
R1401:Epb41l5 UTSW 1 119,506,634 (GRCm39) splice site probably benign
R1416:Epb41l5 UTSW 1 119,477,606 (GRCm39) splice site probably benign
R1452:Epb41l5 UTSW 1 119,476,896 (GRCm39) missense probably damaging 1.00
R1646:Epb41l5 UTSW 1 119,477,752 (GRCm39) splice site probably benign
R1889:Epb41l5 UTSW 1 119,476,902 (GRCm39) missense possibly damaging 0.82
R1895:Epb41l5 UTSW 1 119,476,902 (GRCm39) missense possibly damaging 0.82
R3082:Epb41l5 UTSW 1 119,536,992 (GRCm39) missense probably damaging 1.00
R3742:Epb41l5 UTSW 1 119,532,973 (GRCm39) missense probably benign
R4194:Epb41l5 UTSW 1 119,535,823 (GRCm39) missense probably damaging 1.00
R4787:Epb41l5 UTSW 1 119,523,725 (GRCm39) missense probably benign 0.00
R4983:Epb41l5 UTSW 1 119,482,801 (GRCm39) missense probably benign 0.00
R6825:Epb41l5 UTSW 1 119,547,931 (GRCm39) missense possibly damaging 0.54
R6943:Epb41l5 UTSW 1 119,536,859 (GRCm39) missense probably damaging 1.00
R7334:Epb41l5 UTSW 1 119,551,679 (GRCm39) missense probably damaging 1.00
R8553:Epb41l5 UTSW 1 119,477,671 (GRCm39) missense possibly damaging 0.88
R8904:Epb41l5 UTSW 1 119,547,936 (GRCm39) missense probably damaging 1.00
R8955:Epb41l5 UTSW 1 119,570,292 (GRCm39) missense probably damaging 1.00
R9147:Epb41l5 UTSW 1 119,570,319 (GRCm39) missense probably damaging 1.00
R9258:Epb41l5 UTSW 1 119,506,701 (GRCm39) missense probably benign
R9351:Epb41l5 UTSW 1 119,477,639 (GRCm39) missense probably benign 0.01
R9366:Epb41l5 UTSW 1 119,548,448 (GRCm39) missense probably damaging 1.00
R9370:Epb41l5 UTSW 1 119,561,312 (GRCm39) missense probably damaging 1.00
R9680:Epb41l5 UTSW 1 119,535,804 (GRCm39) missense probably damaging 1.00
R9779:Epb41l5 UTSW 1 119,545,093 (GRCm39) critical splice donor site probably null
Z1177:Epb41l5 UTSW 1 119,536,941 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTCAGCCACAGTATTGTTC -3'
(R):5'- TTCGTCTTTCAGGGCAAAGAAC -3'

Sequencing Primer
(F):5'- CTGTATGAGATAAACCTGTCAGATTG -3'
(R):5'- AAGAACAAGAGCATACCTTTGTC -3'
Posted On 2018-11-28