Incidental Mutation 'R6944:Kcnt2'
ID 540743
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Name potassium channel, subfamily T, member 2
Synonyms E330038N15Rik
MMRRC Submission 045058-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6944 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 140173896-140539805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 140511803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 962 (V962G)
Ref Sequence ENSEMBL: ENSMUSP00000112887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
AlphaFold D3Z649
Predicted Effect probably benign
Transcript: ENSMUST00000119786
AA Change: V919G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: V919G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120709
AA Change: V962G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: V962G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120796
AA Change: V986G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: V986G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,863,693 (GRCm39) V216G probably damaging Het
Abcb5 T C 12: 118,875,265 (GRCm39) R636G probably benign Het
Ago1 G T 4: 126,354,215 (GRCm39) F198L possibly damaging Het
Ankrd42 C T 7: 92,268,755 (GRCm39) probably null Het
Anxa11 T A 14: 25,875,176 (GRCm39) F274I probably damaging Het
Ascc1 T C 10: 59,849,475 (GRCm39) L122P probably damaging Het
Bptf T C 11: 106,971,649 (GRCm39) S953G probably damaging Het
Chml T A 1: 175,515,727 (GRCm39) N65Y probably damaging Het
Clcc1 A G 3: 108,578,284 (GRCm39) K262E probably damaging Het
Clhc1 T G 11: 29,519,346 (GRCm39) D384E probably damaging Het
Cnot2 G A 10: 116,373,128 (GRCm39) probably benign Het
Cntnap1 T C 11: 101,073,730 (GRCm39) V627A probably damaging Het
Col6a4 A G 9: 105,949,370 (GRCm39) V755A probably damaging Het
Cyp4f18 T A 8: 72,743,738 (GRCm39) I406F probably benign Het
Dclre1a T C 19: 56,533,451 (GRCm39) E381G possibly damaging Het
Dnah1 A G 14: 30,990,861 (GRCm39) Y3153H probably damaging Het
Dnah8 C A 17: 31,013,633 (GRCm39) D3791E probably benign Het
Dnah9 T C 11: 65,975,975 (GRCm39) E1358G possibly damaging Het
Eef1g G A 19: 8,945,656 (GRCm39) R30H probably benign Het
Egln3 A T 12: 54,230,738 (GRCm39) I181N probably benign Het
Entpd6 A G 2: 150,605,519 (GRCm39) T250A probably damaging Het
Epb41l5 C T 1: 119,536,859 (GRCm39) R344Q probably damaging Het
Fam20b T C 1: 156,515,091 (GRCm39) D258G probably benign Het
Fbxw18 A T 9: 109,531,655 (GRCm39) D21E probably damaging Het
Fbxw21 T C 9: 108,986,603 (GRCm39) E92G probably damaging Het
Fzd6 T A 15: 38,889,212 (GRCm39) M110K possibly damaging Het
Golgb1 C T 16: 36,732,475 (GRCm39) P574L probably benign Het
Gpr153 A G 4: 152,363,820 (GRCm39) E80G probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
Kcnt1 T C 2: 25,767,840 (GRCm39) probably benign Het
Malt1 T C 18: 65,570,991 (GRCm39) V109A probably benign Het
Marchf7 A G 2: 60,064,587 (GRCm39) I288V probably benign Het
Mief1 C T 15: 80,133,644 (GRCm39) R234C probably damaging Het
Morc3 A G 16: 93,667,460 (GRCm39) S613G probably benign Het
Myt1 A G 2: 181,439,387 (GRCm39) E345G possibly damaging Het
Napb T C 2: 148,548,889 (GRCm39) T133A probably benign Het
Nwd1 T C 8: 73,380,162 (GRCm39) V16A possibly damaging Het
Oas1f G A 5: 120,986,247 (GRCm39) E67K probably benign Het
Obscn T C 11: 58,929,756 (GRCm39) K5153R probably damaging Het
Or2w3b T A 11: 58,623,068 (GRCm39) S308C possibly damaging Het
Or5a3 G T 19: 12,400,628 (GRCm39) M318I probably benign Het
Or5g26 C T 2: 85,494,195 (GRCm39) M194I probably benign Het
Or6d12 T C 6: 116,492,791 (GRCm39) F18L possibly damaging Het
Pdcd2 T C 17: 15,745,632 (GRCm39) N185S possibly damaging Het
Pgap1 A T 1: 54,569,320 (GRCm39) W349R probably damaging Het
Prpf39 T A 12: 65,089,454 (GRCm39) V64E probably benign Het
Ptpn13 T A 5: 103,624,857 (GRCm39) W54R probably null Het
Rbms3 G T 9: 116,939,173 (GRCm39) P29Q probably damaging Het
Rnf123 A G 9: 107,940,822 (GRCm39) L679P probably benign Het
Samd4 T A 14: 47,254,092 (GRCm39) D84E possibly damaging Het
Scarf1 T C 11: 75,413,032 (GRCm39) V426A probably benign Het
Slc12a1 A G 2: 125,002,454 (GRCm39) N145D probably damaging Het
Slc2a6 A T 2: 26,916,076 (GRCm39) M99K probably damaging Het
Slc34a2 A T 5: 53,222,225 (GRCm39) I306L probably benign Het
Slx4ip A G 2: 136,910,195 (GRCm39) K397E probably damaging Het
Smr3a C T 5: 88,155,949 (GRCm39) probably benign Het
Spata31h1 A C 10: 82,132,056 (GRCm39) I318R probably benign Het
Spef2 T C 15: 9,592,835 (GRCm39) E1502G probably damaging Het
Sri A T 5: 8,113,365 (GRCm39) T119S probably benign Het
Synrg T A 11: 83,915,912 (GRCm39) L1085H probably damaging Het
Taf7 A T 18: 37,775,910 (GRCm39) L219H probably damaging Het
Tmco3 T A 8: 13,353,729 (GRCm39) V347E probably damaging Het
Tmem8b A T 4: 43,674,465 (GRCm39) I250F probably damaging Het
Tom1l2 A G 11: 60,139,817 (GRCm39) V239A probably damaging Het
Trpm1 T A 7: 63,893,181 (GRCm39) M1011K probably damaging Het
Tspan9 A T 6: 127,942,769 (GRCm39) Y153N probably benign Het
Ttll11 T C 2: 35,642,306 (GRCm39) H675R probably benign Het
Unc50 C T 1: 37,471,743 (GRCm39) T131M probably damaging Het
Vgf T A 5: 137,061,206 (GRCm39) I456N probably damaging Het
Vmn1r223 A G 13: 23,433,483 (GRCm39) I26V unknown Het
Vmn1r39 T C 6: 66,782,205 (GRCm39) M1V probably null Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r14 T C 5: 109,363,925 (GRCm39) T664A probably benign Het
Vmn2r14 G A 5: 109,364,140 (GRCm39) T592I probably benign Het
Vmn2r96 T A 17: 18,817,891 (GRCm39) F489L probably benign Het
Vmn2r-ps158 T C 7: 42,697,393 (GRCm39) F817L possibly damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140,450,836 (GRCm39) missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140,523,789 (GRCm39) missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140,450,949 (GRCm39) missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140,282,293 (GRCm39) critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140,498,155 (GRCm39) missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140,523,736 (GRCm39) missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140,304,121 (GRCm39) missense probably benign
IGL02350:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02483:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02866:Kcnt2 APN 1 140,352,986 (GRCm39) missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140,502,544 (GRCm39) missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140,282,245 (GRCm39) missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140,498,193 (GRCm39) missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140,461,740 (GRCm39) intron probably benign
BB002:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
BB012:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R0230:Kcnt2 UTSW 1 140,174,083 (GRCm39) missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140,278,963 (GRCm39) missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140,437,218 (GRCm39) nonsense probably null
R0543:Kcnt2 UTSW 1 140,537,352 (GRCm39) missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140,435,500 (GRCm39) missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140,501,346 (GRCm39) missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140,356,593 (GRCm39) missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140,310,766 (GRCm39) missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140,411,970 (GRCm39) nonsense probably null
R1546:Kcnt2 UTSW 1 140,359,116 (GRCm39) missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140,353,068 (GRCm39) missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140,511,985 (GRCm39) missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140,512,031 (GRCm39) missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140,353,079 (GRCm39) missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140,480,756 (GRCm39) missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140,302,892 (GRCm39) missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140,480,701 (GRCm39) missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140,356,551 (GRCm39) missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140,437,179 (GRCm39) missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140,458,538 (GRCm39) missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140,501,421 (GRCm39) splice site probably null
R2442:Kcnt2 UTSW 1 140,304,091 (GRCm39) missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140,356,622 (GRCm39) missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140,461,706 (GRCm39) missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140,512,025 (GRCm39) missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140,537,368 (GRCm39) missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140,353,070 (GRCm39) missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140,480,718 (GRCm39) missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140,435,485 (GRCm39) missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140,450,886 (GRCm39) missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140,446,635 (GRCm39) missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140,282,254 (GRCm39) missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140,440,763 (GRCm39) nonsense probably null
R4973:Kcnt2 UTSW 1 140,537,388 (GRCm39) missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140,278,994 (GRCm39) missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140,537,353 (GRCm39) missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140,354,639 (GRCm39) missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140,502,481 (GRCm39) missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140,437,234 (GRCm39) missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140,353,104 (GRCm39) missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140,461,666 (GRCm39) missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140,435,440 (GRCm39) missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140,290,718 (GRCm39) missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140,354,661 (GRCm39) nonsense probably null
R6248:Kcnt2 UTSW 1 140,437,216 (GRCm39) missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140,302,850 (GRCm39) missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140,437,322 (GRCm39) missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140,511,844 (GRCm39) missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140,278,965 (GRCm39) missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140,173,931 (GRCm39) unclassified probably benign
R6856:Kcnt2 UTSW 1 140,523,742 (GRCm39) missense probably damaging 1.00
R6971:Kcnt2 UTSW 1 140,440,646 (GRCm39) missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140,310,785 (GRCm39) missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140,523,778 (GRCm39) missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140,282,255 (GRCm39) missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140,498,216 (GRCm39) missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140,511,793 (GRCm39) missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140,304,122 (GRCm39) missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140,450,928 (GRCm39) missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140,498,199 (GRCm39) missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140,446,686 (GRCm39) missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140,501,385 (GRCm39) missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140,450,888 (GRCm39) missense probably damaging 0.99
R7925:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R8040:Kcnt2 UTSW 1 140,377,955 (GRCm39) missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140,537,398 (GRCm39) missense probably benign
R8171:Kcnt2 UTSW 1 140,437,203 (GRCm39) missense probably benign 0.13
R8268:Kcnt2 UTSW 1 140,450,954 (GRCm39) missense probably damaging 0.99
R8905:Kcnt2 UTSW 1 140,435,467 (GRCm39) missense possibly damaging 0.65
R8927:Kcnt2 UTSW 1 140,356,535 (GRCm39) splice site probably null
R8988:Kcnt2 UTSW 1 140,356,587 (GRCm39) missense probably benign 0.38
R9020:Kcnt2 UTSW 1 140,512,049 (GRCm39) missense probably benign 0.23
R9109:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9167:Kcnt2 UTSW 1 140,506,200 (GRCm39) missense probably benign 0.11
R9232:Kcnt2 UTSW 1 140,411,931 (GRCm39) missense possibly damaging 0.56
R9297:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9298:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9318:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9404:Kcnt2 UTSW 1 140,353,107 (GRCm39) missense probably damaging 1.00
X0062:Kcnt2 UTSW 1 140,440,729 (GRCm39) missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140,511,896 (GRCm39) nonsense probably null
Z1088:Kcnt2 UTSW 1 140,501,384 (GRCm39) missense probably damaging 1.00
Z1176:Kcnt2 UTSW 1 140,304,099 (GRCm39) missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140,537,386 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCTCCAGAAAAGTTTCGGCAAG -3'
(R):5'- ATCTCCGGTAGAGGTTCAGTCG -3'

Sequencing Primer
(F):5'- TCGGCAAGTTGATTAGTAAACG -3'
(R):5'- AGAGGTTCAGTCGCTGTTGAG -3'
Posted On 2018-11-28