Mutagenetix > Incidental Mutation

Incidental Mutation 'R6944:Kcnt2'

540743

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R6944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 140584065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 962 (V962G)

Ref Sequence

ENSEMBL: ENSMUSP00000112887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably benign
Transcript: ENSMUST00000119786
AA Change: V919G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: V919G

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120709
AA Change: V962G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: V962G

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120796
AA Change: V986G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: V986G

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

97% (75/77)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	C	10: 82,296,222	I318R	probably benign	Het
Abcb1b	T	G	5: 8,813,693	V216G	probably damaging	Het
Abcb5	T	C	12: 118,911,530	R636G	probably benign	Het
Ago1	G	T	4: 126,460,422	F198L	possibly damaging	Het
Ankrd42	C	T	7: 92,619,547		probably null	Het
Anxa11	T	A	14: 25,874,752	F274I	probably damaging	Het
Ascc1	T	C	10: 60,013,653	L122P	probably damaging	Het
Bptf	T	C	11: 107,080,823	S953G	probably damaging	Het
Chml	T	A	1: 175,688,161	N65Y	probably damaging	Het
Clcc1	A	G	3: 108,670,968	K262E	probably damaging	Het
Clhc1	T	G	11: 29,569,346	D384E	probably damaging	Het
Cnot2	G	A	10: 116,537,223		probably benign	Het
Cntnap1	T	C	11: 101,182,904	V627A	probably damaging	Het
Col6a4	A	G	9: 106,072,171	V755A	probably damaging	Het
Cyp4f18	T	A	8: 71,989,894	I406F	probably benign	Het
Dclre1a	T	C	19: 56,545,019	E381G	possibly damaging	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Dnah8	C	A	17: 30,794,659	D3791E	probably benign	Het
Dnah9	T	C	11: 66,085,149	E1358G	possibly damaging	Het
Eef1g	G	A	19: 8,968,292	R30H	probably benign	Het
Egln3	A	T	12: 54,183,952	I181N	probably benign	Het
Entpd6	A	G	2: 150,763,599	T250A	probably damaging	Het
Epb41l5	C	T	1: 119,609,129	R344Q	probably damaging	Het
Fam20b	T	C	1: 156,687,521	D258G	probably benign	Het
Fbxw18	A	T	9: 109,702,587	D21E	probably damaging	Het
Fbxw21	T	C	9: 109,157,535	E92G	probably damaging	Het
Fzd6	T	A	15: 39,025,817	M110K	possibly damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm9268	T	C	7: 43,047,969	F817L	possibly damaging	Het
Golgb1	C	T	16: 36,912,113	P574L	probably benign	Het
Gpr153	A	G	4: 152,279,363	E80G	probably damaging	Het
Kcnt1	T	C	2: 25,877,828		probably benign	Het
Malt1	T	C	18: 65,437,920	V109A	probably benign	Het
March7	A	G	2: 60,234,243	I288V	probably benign	Het
Mief1	C	T	15: 80,249,443	R234C	probably damaging	Het
Morc3	A	G	16: 93,870,572	S613G	probably benign	Het
Myt1	A	G	2: 181,797,594	E345G	possibly damaging	Het
Napb	T	C	2: 148,706,969	T133A	probably benign	Het
Nwd1	T	C	8: 72,653,534	V16A	possibly damaging	Het
Oas1f	G	A	5: 120,848,184	E67K	probably benign	Het
Obscn	T	C	11: 59,038,930	K5153R	probably damaging	Het
Olfr1441	G	T	19: 12,423,264	M318I	probably benign	Het
Olfr154	C	T	2: 85,663,851	M194I	probably benign	Het
Olfr212	T	C	6: 116,515,830	F18L	possibly damaging	Het
Olfr317	T	A	11: 58,732,242	S308C	possibly damaging	Het
Pdcd2	T	C	17: 15,525,370	N185S	possibly damaging	Het
Pgap1	A	T	1: 54,530,161	W349R	probably damaging	Het
Prpf39	T	A	12: 65,042,680	V64E	probably benign	Het
Ptpn13	T	A	5: 103,476,991	W54R	probably null	Het
Rbms3	G	T	9: 117,110,105	P29Q	probably damaging	Het
Rnf123	A	G	9: 108,063,623	L679P	probably benign	Het
Samd4	T	A	14: 47,016,635	D84E	possibly damaging	Het
Scarf1	T	C	11: 75,522,206	V426A	probably benign	Het
Slc12a1	A	G	2: 125,160,534	N145D	probably damaging	Het
Slc2a6	A	T	2: 27,026,064	M99K	probably damaging	Het
Slc34a2	A	T	5: 53,064,883	I306L	probably benign	Het
Slx4ip	A	G	2: 137,068,275	K397E	probably damaging	Het
Smr3a	C	T	5: 88,008,090		probably benign	Het
Spef2	T	C	15: 9,592,749	E1502G	probably damaging	Het
Sri	A	T	5: 8,063,365	T119S	probably benign	Het
Synrg	T	A	11: 84,025,086	L1085H	probably damaging	Het
Taf7	A	T	18: 37,642,857	L219H	probably damaging	Het
Tmco3	T	A	8: 13,303,729	V347E	probably damaging	Het
Tmem8b	A	T	4: 43,674,465	I250F	probably damaging	Het
Tom1l2	A	G	11: 60,248,991	V239A	probably damaging	Het
Trpm1	T	A	7: 64,243,433	M1011K	probably damaging	Het
Tspan9	A	T	6: 127,965,806	Y153N	probably benign	Het
Ttll11	T	C	2: 35,752,294	H675R	probably benign	Het
Unc50	C	T	1: 37,432,662	T131M	probably damaging	Het
Vgf	T	A	5: 137,032,352	I456N	probably damaging	Het
Vmn1r223	A	G	13: 23,249,313	I26V	unknown	Het
Vmn1r39	T	C	6: 66,805,221	M1V	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,059	T664A	probably benign	Het
Vmn2r14	G	A	5: 109,216,274	T592I	probably benign	Het
Vmn2r96	T	A	17: 18,597,629	F489L	probably benign	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GCTCCAGAAAAGTTTCGGCAAG -3'
(R):5'- ATCTCCGGTAGAGGTTCAGTCG -3'

Sequencing Primer
(F):5'- TCGGCAAGTTGATTAGTAAACG -3'
(R):5'- AGAGGTTCAGTCGCTGTTGAG -3'

Posted On

2018-11-28