Incidental Mutation 'R6944:Olfr154'
ID540750
Institutional Source Beutler Lab
Gene Symbol Olfr154
Ensembl Gene ENSMUSG00000075212
Gene Nameolfactory receptor 154
SynonymsOlfr4-3, GA_x6K02T2Q125-47143827-47142871, 912-93, MOR175-1, OR93
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6944 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85663377-85664455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85663851 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 194 (M194I)
Ref Sequence ENSEMBL: ENSMUSP00000097502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099918]
Predicted Effect probably benign
Transcript: ENSMUST00000099918
AA Change: M194I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097502
Gene: ENSMUSG00000075212
AA Change: M194I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-49 PFAM
Pfam:7tm_1 41 290 1.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,222 I318R probably benign Het
Abcb1b T G 5: 8,813,693 V216G probably damaging Het
Abcb5 T C 12: 118,911,530 R636G probably benign Het
Ago1 G T 4: 126,460,422 F198L possibly damaging Het
Ankrd42 C T 7: 92,619,547 probably null Het
Anxa11 T A 14: 25,874,752 F274I probably damaging Het
Ascc1 T C 10: 60,013,653 L122P probably damaging Het
Bptf T C 11: 107,080,823 S953G probably damaging Het
Chml T A 1: 175,688,161 N65Y probably damaging Het
Clcc1 A G 3: 108,670,968 K262E probably damaging Het
Clhc1 T G 11: 29,569,346 D384E probably damaging Het
Cnot2 G A 10: 116,537,223 probably benign Het
Cntnap1 T C 11: 101,182,904 V627A probably damaging Het
Col6a4 A G 9: 106,072,171 V755A probably damaging Het
Cyp4f18 T A 8: 71,989,894 I406F probably benign Het
Dclre1a T C 19: 56,545,019 E381G possibly damaging Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Dnah8 C A 17: 30,794,659 D3791E probably benign Het
Dnah9 T C 11: 66,085,149 E1358G possibly damaging Het
Eef1g G A 19: 8,968,292 R30H probably benign Het
Egln3 A T 12: 54,183,952 I181N probably benign Het
Entpd6 A G 2: 150,763,599 T250A probably damaging Het
Epb41l5 C T 1: 119,609,129 R344Q probably damaging Het
Fam20b T C 1: 156,687,521 D258G probably benign Het
Fbxw18 A T 9: 109,702,587 D21E probably damaging Het
Fbxw21 T C 9: 109,157,535 E92G probably damaging Het
Fzd6 T A 15: 39,025,817 M110K possibly damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm9268 T C 7: 43,047,969 F817L possibly damaging Het
Golgb1 C T 16: 36,912,113 P574L probably benign Het
Gpr153 A G 4: 152,279,363 E80G probably damaging Het
Kcnt1 T C 2: 25,877,828 probably benign Het
Kcnt2 T G 1: 140,584,065 V962G probably benign Het
Malt1 T C 18: 65,437,920 V109A probably benign Het
March7 A G 2: 60,234,243 I288V probably benign Het
Mief1 C T 15: 80,249,443 R234C probably damaging Het
Morc3 A G 16: 93,870,572 S613G probably benign Het
Myt1 A G 2: 181,797,594 E345G possibly damaging Het
Napb T C 2: 148,706,969 T133A probably benign Het
Nwd1 T C 8: 72,653,534 V16A possibly damaging Het
Oas1f G A 5: 120,848,184 E67K probably benign Het
Obscn T C 11: 59,038,930 K5153R probably damaging Het
Olfr1441 G T 19: 12,423,264 M318I probably benign Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr317 T A 11: 58,732,242 S308C possibly damaging Het
Pdcd2 T C 17: 15,525,370 N185S possibly damaging Het
Pgap1 A T 1: 54,530,161 W349R probably damaging Het
Prpf39 T A 12: 65,042,680 V64E probably benign Het
Ptpn13 T A 5: 103,476,991 W54R probably null Het
Rbms3 G T 9: 117,110,105 P29Q probably damaging Het
Rnf123 A G 9: 108,063,623 L679P probably benign Het
Samd4 T A 14: 47,016,635 D84E possibly damaging Het
Scarf1 T C 11: 75,522,206 V426A probably benign Het
Slc12a1 A G 2: 125,160,534 N145D probably damaging Het
Slc2a6 A T 2: 27,026,064 M99K probably damaging Het
Slc34a2 A T 5: 53,064,883 I306L probably benign Het
Slx4ip A G 2: 137,068,275 K397E probably damaging Het
Smr3a C T 5: 88,008,090 probably benign Het
Spef2 T C 15: 9,592,749 E1502G probably damaging Het
Sri A T 5: 8,063,365 T119S probably benign Het
Synrg T A 11: 84,025,086 L1085H probably damaging Het
Taf7 A T 18: 37,642,857 L219H probably damaging Het
Tmco3 T A 8: 13,303,729 V347E probably damaging Het
Tmem8b A T 4: 43,674,465 I250F probably damaging Het
Tom1l2 A G 11: 60,248,991 V239A probably damaging Het
Trpm1 T A 7: 64,243,433 M1011K probably damaging Het
Tspan9 A T 6: 127,965,806 Y153N probably benign Het
Ttll11 T C 2: 35,752,294 H675R probably benign Het
Unc50 C T 1: 37,432,662 T131M probably damaging Het
Vgf T A 5: 137,032,352 I456N probably damaging Het
Vmn1r223 A G 13: 23,249,313 I26V unknown Het
Vmn1r39 T C 6: 66,805,221 M1V probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r14 T C 5: 109,216,059 T664A probably benign Het
Vmn2r14 G A 5: 109,216,274 T592I probably benign Het
Vmn2r96 T A 17: 18,597,629 F489L probably benign Het
Other mutations in Olfr154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr154 APN 2 85664356 missense probably benign 0.23
IGL01745:Olfr154 APN 2 85663577 missense possibly damaging 0.76
R1937:Olfr154 UTSW 2 85663997 missense probably benign
R2086:Olfr154 UTSW 2 85663746 missense probably benign
R2876:Olfr154 UTSW 2 85663690 missense probably damaging 1.00
R3881:Olfr154 UTSW 2 85664425 missense probably benign 0.00
R4801:Olfr154 UTSW 2 85664278 missense probably damaging 1.00
R4802:Olfr154 UTSW 2 85664278 missense probably damaging 1.00
R6010:Olfr154 UTSW 2 85664030 missense probably benign 0.00
R7089:Olfr154 UTSW 2 85664174 missense possibly damaging 0.79
R7443:Olfr154 UTSW 2 85663568 missense probably damaging 1.00
R7453:Olfr154 UTSW 2 85664180 missense probably benign
R7736:Olfr154 UTSW 2 85664414 missense probably damaging 1.00
R7853:Olfr154 UTSW 2 85664345 missense probably benign
Z1088:Olfr154 UTSW 2 85663616 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTCCCGTAAAGAATAGAGACTGC -3'
(R):5'- CGGTATGTTGCCATCTGTAAGC -3'

Sequencing Primer
(F):5'- ACTGCTGTCAGGTGTGAAGAGC -3'
(R):5'- GTATACTCTCATCATGTCCCAGCGAG -3'
Posted On2018-11-28